Incidental Mutation 'R9658:Usp17lc'
ID 735541
Institutional Source Beutler Lab
Gene Symbol Usp17lc
Ensembl Gene ENSMUSG00000058976
Gene Name ubiquitin specific peptidase 17-like C
Synonyms Dub2, Usp17l5, Dub2b, Dub-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9658 (G1)
Quality Score 155.008
Status Not validated
Chromosome 7
Chromosomal Location 103415072-103419880 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103418182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 228 (G228D)
Ref Sequence ENSEMBL: ENSMUSP00000078323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079348] [ENSMUST00000106892]
AlphaFold G5E8I7
Predicted Effect possibly damaging
Transcript: ENSMUST00000079348
AA Change: G228D

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078323
Gene: ENSMUSG00000058976
AA Change: G228D

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.8e-54 PFAM
Pfam:UCH_1 51 327 3.5e-25 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106892
AA Change: G228D

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102505
Gene: ENSMUSG00000058976
AA Change: G228D

DomainStartEndE-ValueType
Pfam:UCH 50 345 1.3e-60 PFAM
Pfam:UCH_1 51 327 5.5e-30 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic elthality before implantation, failure to hatch from the zona pellucida, decreased cell proliferation and increased apoptosis. Mice heterozygous for this allele exhibit abnormal body, testis and thymus weight and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik C T 18: 70,467,330 probably null Het
Abca12 T C 1: 71,286,475 I1521M probably damaging Het
Abcc3 A G 11: 94,372,877 S268P possibly damaging Het
Adamts20 G C 15: 94,351,745 P464A probably damaging Het
Apoa1 C A 9: 46,229,982 D125E probably benign Het
Atp6v0a1 C A 11: 101,018,588 Q48K probably benign Het
Bptf T C 11: 107,111,344 N314S probably damaging Het
Cdh7 T C 1: 110,061,055 V229A probably damaging Het
Cfap46 G A 7: 139,666,313 T378M Het
Clca3b T A 3: 144,837,814 D418V probably damaging Het
Dennd4c T A 4: 86,836,388 L1545* probably null Het
Dnajc13 A G 9: 104,238,529 V27A probably benign Het
Eif2ak2 A T 17: 78,876,203 D72E probably benign Het
Eif2ak4 T C 2: 118,439,030 I862T probably damaging Het
Eif4g1 T C 16: 20,684,113 I1022T probably benign Het
Enpp3 A T 10: 24,773,904 *875R probably null Het
F11 T C 8: 45,245,634 Y491C probably damaging Het
Fam155a T C 8: 9,770,114 D302G probably benign Het
Fam98c A C 7: 29,152,781 W118G probably damaging Het
Fbxo43 A T 15: 36,152,136 L509Q probably damaging Het
Fbxw5 A G 2: 25,503,858 H366R probably damaging Het
Flt1 G T 5: 147,588,567 N920K probably damaging Het
Git1 T A 11: 77,499,755 F106I probably damaging Het
Glipr1l2 A G 10: 112,106,963 E241G probably damaging Het
Gm11639 A G 11: 104,720,294 K321E probably benign Het
Gm2381 A C 7: 42,820,305 C132G probably damaging Het
Gm49383 A G 12: 69,192,854 I237T Het
Gm7324 T A 14: 43,714,825 D308E probably benign Het
Gpr17 A G 18: 31,947,368 L214P probably damaging Het
Gtf3c1 A T 7: 125,707,562 L39Q probably damaging Het
H2-Q6 C T 17: 35,425,209 R56C probably damaging Het
Hcar2 T C 5: 123,864,469 T324A possibly damaging Het
Ksr2 T C 5: 117,747,360 S750P probably damaging Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Map4k3 C A 17: 80,653,877 M133I probably benign Het
Marf1 A T 16: 14,140,223 L805Q probably damaging Het
Mccc2 T A 13: 99,954,246 R460W probably damaging Het
Mgam A G 6: 40,744,377 D312G possibly damaging Het
Nadk2 A T 15: 9,103,361 K360* probably null Het
Nars2 A G 7: 97,039,971 I367V probably benign Het
Nppb T C 4: 147,986,494 S109P possibly damaging Het
Odf2 G A 2: 29,889,801 R15Q probably benign Het
Olfr1312 C A 2: 112,042,478 A185S probably damaging Het
Olfr209 A T 16: 59,361,743 H158Q probably damaging Het
Olfr630 C T 7: 103,754,821 V255M probably damaging Het
Osbpl1a A T 18: 12,756,212 I949N probably benign Het
Pan3 T C 5: 147,543,071 F55L probably benign Het
Patj A G 4: 98,465,140 D640G probably null Het
Pdxk T C 10: 78,451,569 K53E probably benign Het
Pja2 A G 17: 64,292,873 S539P probably damaging Het
Plscr1 T A 9: 92,266,482 C158* probably null Het
Prdm14 T C 1: 13,118,921 T400A probably benign Het
Rag1 C T 2: 101,642,884 V638M possibly damaging Het
Ros1 A G 10: 52,090,973 S1734P probably damaging Het
S100a9 T C 3: 90,692,774 H105R unknown Het
Shisa9 A T 16: 12,244,656 Q247L possibly damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc27a4 G A 2: 29,811,289 R364Q probably damaging Het
Spag17 C T 3: 100,027,616 P713S possibly damaging Het
Tbc1d4 T A 14: 101,608,420 H14L probably damaging Het
Tmem144 T A 3: 79,822,684 Y253F probably damaging Het
Tmem204 C T 17: 25,080,348 G66R possibly damaging Het
Tnfrsf1b A T 4: 145,215,854 V453E probably damaging Het
Tns1 G C 1: 73,942,023 Q1061E probably benign Het
Tns1 G T 1: 73,942,024 N1060K probably benign Het
Trav5-1 A G 14: 52,622,971 K78E probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Uvssa T C 5: 33,410,989 C574R probably damaging Het
Veph1 G A 3: 66,264,013 Q3* probably null Het
Vps13b T A 15: 35,623,628 D1230E probably benign Het
Xkr9 T A 1: 13,701,094 I278N probably damaging Het
Zbed4 C A 15: 88,780,539 A270E probably benign Het
Zfp366 A T 13: 99,228,927 T199S probably benign Het
Other mutations in Usp17lc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Usp17lc APN 7 103418941 missense possibly damaging 0.74
IGL00499:Usp17lc APN 7 103418466 missense probably damaging 1.00
IGL00499:Usp17lc APN 7 103418465 missense probably damaging 1.00
IGL01446:Usp17lc APN 7 103418444 missense probably benign 0.00
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1584:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1754:Usp17lc UTSW 7 103418848 missense probably benign 0.01
R2987:Usp17lc UTSW 7 103418302 missense probably damaging 0.99
R3969:Usp17lc UTSW 7 103418419 missense probably damaging 1.00
R4661:Usp17lc UTSW 7 103418590 missense probably benign 0.00
R5118:Usp17lc UTSW 7 103418661 missense probably benign 0.05
R5413:Usp17lc UTSW 7 103418556 missense probably benign
R6962:Usp17lc UTSW 7 103418911 missense probably benign 0.00
R7412:Usp17lc UTSW 7 103418368 missense probably damaging 1.00
R7638:Usp17lc UTSW 7 103418499 missense probably damaging 1.00
R7748:Usp17lc UTSW 7 103418481 missense probably damaging 1.00
R8194:Usp17lc UTSW 7 103418200 missense probably benign 0.00
R8303:Usp17lc UTSW 7 103418182 missense possibly damaging 0.88
R8815:Usp17lc UTSW 7 103418317 missense probably benign 0.01
R8859:Usp17lc UTSW 7 103415109 missense probably benign 0.01
R9023:Usp17lc UTSW 7 103418332 missense possibly damaging 0.88
R9200:Usp17lc UTSW 7 103418898 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGGCTTGTGGAGGTCTCAGATC -3'
(R):5'- GTGACAAGTCGCACCTTCATG -3'

Sequencing Primer
(F):5'- AGATCAAGTGTCTCCATTGCCAGG -3'
(R):5'- CTTCATGGACCAGGACAGCATAG -3'
Posted On 2022-11-14