Incidental Mutation 'R9658:Atp6v0a1'
ID 735556
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms V-ATPase a1, Vpp-1, Vpp1, Atp6n1, Atp6n1a
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9658 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100900278-100954545 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100909414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 48 (Q48K)
Ref Sequence ENSEMBL: ENSMUSP00000044838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000139619] [ENSMUST00000168757]
AlphaFold Q9Z1G4
Predicted Effect probably benign
Transcript: ENSMUST00000044721
AA Change: Q48K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: Q48K

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092663
AA Change: Q48K

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: Q48K

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103110
AA Change: Q48K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: Q48K

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139619
AA Change: Q48K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121247
Gene: ENSMUSG00000019302
AA Change: Q48K

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 79 4.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168757
AA Change: Q48K

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: Q48K

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik C T 18: 70,600,401 (GRCm39) probably null Het
Abca12 T C 1: 71,325,634 (GRCm39) I1521M probably damaging Het
Abcc3 A G 11: 94,263,703 (GRCm39) S268P possibly damaging Het
Adamts20 G C 15: 94,249,626 (GRCm39) P464A probably damaging Het
Apoa1 C A 9: 46,141,280 (GRCm39) D125E probably benign Het
Bptf T C 11: 107,002,170 (GRCm39) N314S probably damaging Het
Cdh20 T C 1: 109,988,785 (GRCm39) V229A probably damaging Het
Cfap46 G A 7: 139,246,229 (GRCm39) T378M Het
Clca3b T A 3: 144,543,575 (GRCm39) D418V probably damaging Het
Dennd4c T A 4: 86,754,625 (GRCm39) L1545* probably null Het
Dnajc13 A G 9: 104,115,728 (GRCm39) V27A probably benign Het
Efcab3 A G 11: 104,611,120 (GRCm39) K321E probably benign Het
Eif2ak2 A T 17: 79,183,632 (GRCm39) D72E probably benign Het
Eif2ak4 T C 2: 118,269,511 (GRCm39) I862T probably damaging Het
Eif4g1 T C 16: 20,502,863 (GRCm39) I1022T probably benign Het
Enpp3 A T 10: 24,649,802 (GRCm39) *875R probably null Het
F11 T C 8: 45,698,671 (GRCm39) Y491C probably damaging Het
Fam98c A C 7: 28,852,206 (GRCm39) W118G probably damaging Het
Fbxo43 A T 15: 36,152,282 (GRCm39) L509Q probably damaging Het
Fbxw5 A G 2: 25,393,870 (GRCm39) H366R probably damaging Het
Flt1 G T 5: 147,525,377 (GRCm39) N920K probably damaging Het
Git1 T A 11: 77,390,581 (GRCm39) F106I probably damaging Het
Glipr1l2 A G 10: 111,942,868 (GRCm39) E241G probably damaging Het
Gm2381 A C 7: 42,469,729 (GRCm39) C132G probably damaging Het
Gm49383 A G 12: 69,239,628 (GRCm39) I237T Het
Gm7324 T A 14: 43,952,282 (GRCm39) D308E probably benign Het
Gpr17 A G 18: 32,080,421 (GRCm39) L214P probably damaging Het
Gtf3c1 A T 7: 125,306,734 (GRCm39) L39Q probably damaging Het
H2-Q6 C T 17: 35,644,185 (GRCm39) R56C probably damaging Het
Hcar2 T C 5: 124,002,532 (GRCm39) T324A possibly damaging Het
Ksr2 T C 5: 117,885,425 (GRCm39) S750P probably damaging Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Map4k3 C A 17: 80,961,306 (GRCm39) M133I probably benign Het
Marf1 A T 16: 13,958,087 (GRCm39) L805Q probably damaging Het
Mccc2 T A 13: 100,090,754 (GRCm39) R460W probably damaging Het
Mgam A G 6: 40,721,311 (GRCm39) D312G possibly damaging Het
Nadk2 A T 15: 9,103,449 (GRCm39) K360* probably null Het
Nalf1 T C 8: 9,820,114 (GRCm39) D302G probably benign Het
Nars2 A G 7: 96,689,178 (GRCm39) I367V probably benign Het
Nppb T C 4: 148,070,951 (GRCm39) S109P possibly damaging Het
Odf2 G A 2: 29,779,813 (GRCm39) R15Q probably benign Het
Or4f59 C A 2: 111,872,823 (GRCm39) A185S probably damaging Het
Or51l4 C T 7: 103,404,028 (GRCm39) V255M probably damaging Het
Or5ac25 A T 16: 59,182,106 (GRCm39) H158Q probably damaging Het
Osbpl1a A T 18: 12,889,269 (GRCm39) I949N probably benign Het
Pan3 T C 5: 147,479,881 (GRCm39) F55L probably benign Het
Patj A G 4: 98,353,377 (GRCm39) D640G probably null Het
Pdxk T C 10: 78,287,403 (GRCm39) K53E probably benign Het
Pja2 A G 17: 64,599,868 (GRCm39) S539P probably damaging Het
Plscr1 T A 9: 92,148,535 (GRCm39) C158* probably null Het
Prdm14 T C 1: 13,189,145 (GRCm39) T400A probably benign Het
Rag1 C T 2: 101,473,229 (GRCm39) V638M possibly damaging Het
Ros1 A G 10: 51,967,069 (GRCm39) S1734P probably damaging Het
S100a9 T C 3: 90,600,081 (GRCm39) H105R unknown Het
Shisa9 A T 16: 12,062,520 (GRCm39) Q247L possibly damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc27a4 G A 2: 29,701,301 (GRCm39) R364Q probably damaging Het
Spag17 C T 3: 99,934,932 (GRCm39) P713S possibly damaging Het
Tbc1d4 T A 14: 101,845,856 (GRCm39) H14L probably damaging Het
Tmem144 T A 3: 79,729,991 (GRCm39) Y253F probably damaging Het
Tmem204 C T 17: 25,299,322 (GRCm39) G66R possibly damaging Het
Tnfrsf1b A T 4: 144,942,424 (GRCm39) V453E probably damaging Het
Tns1 G C 1: 73,981,182 (GRCm39) Q1061E probably benign Het
Tns1 G T 1: 73,981,183 (GRCm39) N1060K probably benign Het
Trav5-1 A G 14: 52,860,428 (GRCm39) K78E probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Usp17lc G A 7: 103,067,389 (GRCm39) G228D possibly damaging Het
Uvssa T C 5: 33,568,333 (GRCm39) C574R probably damaging Het
Veph1 G A 3: 66,171,434 (GRCm39) Q3* probably null Het
Vps13b T A 15: 35,623,774 (GRCm39) D1230E probably benign Het
Xkr9 T A 1: 13,771,318 (GRCm39) I278N probably damaging Het
Zbed4 C A 15: 88,664,742 (GRCm39) A270E probably benign Het
Zfp366 A T 13: 99,365,435 (GRCm39) T199S probably benign Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 100,921,331 (GRCm39) critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 100,939,265 (GRCm39) missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 100,934,628 (GRCm39) missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 100,930,666 (GRCm39) missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 100,946,344 (GRCm39) missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 100,929,677 (GRCm39) splice site probably null
R0193:Atp6v0a1 UTSW 11 100,939,308 (GRCm39) missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 100,939,341 (GRCm39) missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0974:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R1460:Atp6v0a1 UTSW 11 100,924,824 (GRCm39) missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 100,920,030 (GRCm39) missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 100,946,380 (GRCm39) missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 100,929,612 (GRCm39) missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 100,917,511 (GRCm39) missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 100,935,424 (GRCm39) missense probably benign
R2926:Atp6v0a1 UTSW 11 100,934,774 (GRCm39) missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 100,921,246 (GRCm39) missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 100,946,343 (GRCm39) missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 100,933,776 (GRCm39) missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 100,911,341 (GRCm39) missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 100,933,870 (GRCm39) missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 100,946,413 (GRCm39) missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 100,929,633 (GRCm39) missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 100,920,011 (GRCm39) missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 100,909,400 (GRCm39) missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 100,930,715 (GRCm39) missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 100,945,886 (GRCm39) missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 100,920,009 (GRCm39) missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 100,918,183 (GRCm39) missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 100,924,868 (GRCm39) missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 100,934,783 (GRCm39) missense probably benign 0.08
R8289:Atp6v0a1 UTSW 11 100,924,931 (GRCm39) missense probably damaging 1.00
R8461:Atp6v0a1 UTSW 11 100,935,400 (GRCm39) missense possibly damaging 0.60
R8680:Atp6v0a1 UTSW 11 100,953,229 (GRCm39) makesense probably null
R8725:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8727:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8935:Atp6v0a1 UTSW 11 100,929,519 (GRCm39) missense possibly damaging 0.90
R9762:Atp6v0a1 UTSW 11 100,946,427 (GRCm39) missense possibly damaging 0.46
R9779:Atp6v0a1 UTSW 11 100,924,938 (GRCm39) missense probably damaging 1.00
X0023:Atp6v0a1 UTSW 11 100,935,423 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCCTTTCTATCGATCAGTGG -3'
(R):5'- TAAACTGCAAAGGGCCAGC -3'

Sequencing Primer
(F):5'- TCTATCGATCAGTGGATAATCTTGG -3'
(R):5'- GGTAACTAATATCCTGCTGGCAGC -3'
Posted On 2022-11-14