Incidental Mutation 'R9664:Aqr'
ID 735592
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Name aquarius
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9664 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 114101170-114187024 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 114140915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 480 (E480*)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
AlphaFold Q8CFQ3
Predicted Effect probably null
Transcript: ENSMUST00000043160
AA Change: E480*
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: E480*

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102543
AA Change: E480*
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: E480*

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 G A 15: 76,594,183 D277N probably damaging Het
Adgrv1 A T 13: 81,522,169 S2353T probably benign Het
Adgrv1 A T 13: 81,595,252 N43K probably damaging Het
Adnp2 A G 18: 80,142,722 I12T probably damaging Het
Ahnak2 A G 12: 112,774,929 L903P probably damaging Het
Ankhd1 T G 18: 36,647,825 S1977A probably benign Het
Ap1m2 T C 9: 21,305,687 M118V probably benign Het
Ap3d1 T C 10: 80,712,805 K846R possibly damaging Het
Arl6 G T 16: 59,613,836 Q182K probably benign Het
Arpc2 A G 1: 74,254,875 K106E probably benign Het
Atp8a1 A C 5: 67,732,181 F599V Het
B3galt5 A T 16: 96,316,003 I279F probably damaging Het
Calcoco2 G T 11: 96,100,278 A211D unknown Het
Ccdc33 T C 9: 58,086,572 E342G possibly damaging Het
Ccdc88a C A 11: 29,455,484 Q386K probably benign Het
Cdh20 A G 1: 104,934,340 K82E probably benign Het
Clca3a2 A T 3: 144,797,814 Y792N probably damaging Het
Col6a6 T C 9: 105,781,055 I653V probably benign Het
Col7a1 C T 9: 108,983,581 R2826W unknown Het
D6Ertd527e A G 6: 87,111,926 N357S unknown Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dnajc6 A G 4: 101,618,624 N565D probably benign Het
Doc2g A G 19: 4,004,390 Y155C probably damaging Het
Dot1l G A 10: 80,788,527 G943D probably damaging Het
Dst T C 1: 34,181,655 V2180A probably benign Het
Eftud2 A C 11: 102,868,596 Y160* probably null Het
Ehd1 A T 19: 6,281,232 Q140L probably benign Het
Etv3 T C 3: 87,535,865 V252A probably benign Het
F11 A T 8: 45,241,529 C598* probably null Het
Fancm T A 12: 65,090,984 N316K probably benign Het
Flnc T C 6: 29,457,215 V2372A probably damaging Het
Fry A G 5: 150,359,023 R338G probably damaging Het
Gfra3 T C 18: 34,704,538 T136A probably benign Het
Golga7b T C 19: 42,267,023 V113A possibly damaging Het
Gpn3 G T 5: 122,382,243 V102L Het
Herc2 A G 7: 56,170,590 N2859S possibly damaging Het
Hpd A T 5: 123,180,885 probably null Het
Hspg2 C T 4: 137,539,576 T1964I probably benign Het
Hydin A T 8: 110,494,333 T1454S probably benign Het
Irgm2 A T 11: 58,220,046 T188S possibly damaging Het
Jak3 A G 8: 71,678,722 D77G probably damaging Het
Kcnj4 G T 15: 79,485,019 F253L possibly damaging Het
Kidins220 T A 12: 25,056,896 D1358E probably benign Het
Klf1 C A 8: 84,903,432 C295* probably null Het
Kmt2a C T 9: 44,848,805 W582* probably null Het
Lrig2 A G 3: 104,464,240 C716R probably damaging Het
Lrp1b C T 2: 40,874,992 D2941N Het
Lrpprc A T 17: 84,712,834 V1141E probably damaging Het
Mrgprx1 C T 7: 48,021,525 G158D probably benign Het
Muc5b C A 7: 141,855,542 A1121D unknown Het
Nf1 G T 11: 79,443,907 V852L probably damaging Het
Nlrp5 A G 7: 23,418,861 E670G probably benign Het
Notch4 A G 17: 34,565,627 T101A probably benign Het
Olfr1487 G A 19: 13,620,001 V237I probably benign Het
Olfr517 T C 7: 108,868,356 Y266C probably damaging Het
Olfr721-ps1 T A 14: 14,407,963 I245K probably benign Het
P2rx2 T C 5: 110,340,306 T461A probably benign Het
Pank1 G A 19: 34,821,794 T419I probably damaging Het
Patz1 T C 11: 3,294,562 V481A unknown Het
Pdlim5 A G 3: 142,312,297 L179P probably benign Het
Pik3ap1 A T 19: 41,308,528 V461D probably damaging Het
Polq T C 16: 37,027,814 V261A probably damaging Het
Ppm1a G A 12: 72,790,677 V333M possibly damaging Het
R3hcc1l T C 19: 42,564,232 L556P probably benign Het
Rabggta G A 14: 55,718,918 Q365* probably null Het
Ranbp9 T C 13: 43,425,043 T185A probably benign Het
Rd3l T G 12: 111,979,479 N189H probably damaging Het
Rnf17 A G 14: 56,485,179 T1066A probably damaging Het
Rnf213 G A 11: 119,441,968 A2669T Het
Ros1 T A 10: 52,120,835 H1268L probably benign Het
Rps6ka4 G T 19: 6,831,986 S433R possibly damaging Het
Ryr1 A G 7: 29,059,667 L3362P probably damaging Het
Setd1b A T 5: 123,159,983 T1361S unknown Het
Setd2 T C 9: 110,548,502 S462P probably damaging Het
Sgsm3 A T 15: 81,006,734 Q132L probably benign Het
Slx1b C A 7: 126,692,526 R122L probably damaging Het
Sorbs2 A T 8: 45,823,751 T1167S probably benign Het
Spdya A C 17: 71,562,518 T103P probably damaging Het
Stfa2 A G 16: 36,408,276 S20P probably benign Het
Sulf1 A G 1: 12,820,802 T400A probably benign Het
Tardbp A T 4: 148,625,294 D23E probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tgm1 C T 14: 55,710,984 D237N probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tmem198 A T 1: 75,482,628 I76F possibly damaging Het
Trpv2 A T 11: 62,584,559 Y266F probably damaging Het
Ttn C T 2: 76,739,501 G27016E probably damaging Het
Ttn T C 2: 76,951,480 E1074G unknown Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Usp38 A G 8: 81,014,535 probably benign Het
Vmn1r79 A G 7: 12,176,655 T155A probably benign Het
Vwce G A 19: 10,638,117 V121I probably benign Het
Wdr63 T C 3: 146,042,839 N840S probably benign Het
Wdr91 A T 6: 34,889,026 D530E probably benign Het
Wnt4 A G 4: 137,296,618 T299A probably benign Het
Yeats2 T A 16: 20,228,741 Y1284* probably null Het
Zfp113 A T 5: 138,150,626 Y85* probably null Het
Zfp184 A G 13: 21,959,926 T601A probably benign Het
Zfp655 A G 5: 145,243,632 E100G probably damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
R8904:Aqr UTSW 2 114136993 missense probably damaging 0.98
R9487:Aqr UTSW 2 114104047 missense probably benign 0.04
R9527:Aqr UTSW 2 114101556 missense probably benign 0.02
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCCACATCTCCAAGGTACTC -3'
(R):5'- CTCAGTAGCTGCTTCTCCAG -3'

Sequencing Primer
(F):5'- CACATCTCCAAGGTACTCAAATATG -3'
(R):5'- GCTTCTCCAGCTGCTAGTGTG -3'
Posted On 2022-11-14