Incidental Mutation 'R9664:Clca3a2'
ID 735596
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9664 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144502320-144525255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144503575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 792 (Y792N)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably damaging
Transcript: ENSMUST00000029929
AA Change: Y792N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: Y792N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 G A 15: 76,478,383 (GRCm39) D277N probably damaging Het
Adgrv1 A T 13: 81,670,288 (GRCm39) S2353T probably benign Het
Adgrv1 A T 13: 81,743,371 (GRCm39) N43K probably damaging Het
Adnp2 A G 18: 80,185,937 (GRCm39) I12T probably damaging Het
Ahnak2 A G 12: 112,741,363 (GRCm39) L903P probably damaging Het
Ankhd1 T G 18: 36,780,878 (GRCm39) S1977A probably benign Het
Ap1m2 T C 9: 21,216,983 (GRCm39) M118V probably benign Het
Ap3d1 T C 10: 80,548,639 (GRCm39) K846R possibly damaging Het
Aqr C A 2: 113,971,396 (GRCm39) E480* probably null Het
Arl6 G T 16: 59,434,199 (GRCm39) Q182K probably benign Het
Arpc2 A G 1: 74,294,034 (GRCm39) K106E probably benign Het
Atp8a1 A C 5: 67,889,524 (GRCm39) F599V Het
B3galt5 A T 16: 96,117,203 (GRCm39) I279F probably damaging Het
Calcoco2 G T 11: 95,991,104 (GRCm39) A211D unknown Het
Ccdc33 T C 9: 57,993,855 (GRCm39) E342G possibly damaging Het
Ccdc88a C A 11: 29,405,484 (GRCm39) Q386K probably benign Het
Cdh20 A G 1: 104,862,065 (GRCm39) K82E probably benign Het
Col6a6 T C 9: 105,658,254 (GRCm39) I653V probably benign Het
Col7a1 C T 9: 108,812,649 (GRCm39) R2826W unknown Het
D6Ertd527e A G 6: 87,088,908 (GRCm39) N357S unknown Het
Dmgdh T A 13: 93,857,123 (GRCm39) N742K probably benign Het
Dnai3 T C 3: 145,748,594 (GRCm39) N840S probably benign Het
Dnajc6 A G 4: 101,475,821 (GRCm39) N565D probably benign Het
Doc2g A G 19: 4,054,390 (GRCm39) Y155C probably damaging Het
Dot1l G A 10: 80,624,361 (GRCm39) G943D probably damaging Het
Dst T C 1: 34,220,736 (GRCm39) V2180A probably benign Het
Eftud2 A C 11: 102,759,422 (GRCm39) Y160* probably null Het
Ehd1 A T 19: 6,331,262 (GRCm39) Q140L probably benign Het
Etv3 T C 3: 87,443,172 (GRCm39) V252A probably benign Het
F11 A T 8: 45,694,566 (GRCm39) C598* probably null Het
Fancm T A 12: 65,137,758 (GRCm39) N316K probably benign Het
Flnc T C 6: 29,457,214 (GRCm39) V2372A probably damaging Het
Fry A G 5: 150,282,488 (GRCm39) R338G probably damaging Het
Gfra3 T C 18: 34,837,591 (GRCm39) T136A probably benign Het
Golga7b T C 19: 42,255,462 (GRCm39) V113A possibly damaging Het
Gpn3 G T 5: 122,520,306 (GRCm39) V102L Het
Herc2 A G 7: 55,820,338 (GRCm39) N2859S possibly damaging Het
Hpd A T 5: 123,318,948 (GRCm39) probably null Het
Hspg2 C T 4: 137,266,887 (GRCm39) T1964I probably benign Het
Hydin A T 8: 111,220,965 (GRCm39) T1454S probably benign Het
Irgm2 A T 11: 58,110,872 (GRCm39) T188S possibly damaging Het
Jak3 A G 8: 72,131,366 (GRCm39) D77G probably damaging Het
Kcnj4 G T 15: 79,369,220 (GRCm39) F253L possibly damaging Het
Kidins220 T A 12: 25,106,895 (GRCm39) D1358E probably benign Het
Klf1 C A 8: 85,630,061 (GRCm39) C295* probably null Het
Kmt2a C T 9: 44,760,102 (GRCm39) W582* probably null Het
Lrig2 A G 3: 104,371,556 (GRCm39) C716R probably damaging Het
Lrp1b C T 2: 40,765,004 (GRCm39) D2941N Het
Lrpprc A T 17: 85,020,262 (GRCm39) V1141E probably damaging Het
Mrgprx1 C T 7: 47,671,273 (GRCm39) G158D probably benign Het
Muc5b C A 7: 141,409,279 (GRCm39) A1121D unknown Het
Nf1 G T 11: 79,334,733 (GRCm39) V852L probably damaging Het
Nlrp5 A G 7: 23,118,286 (GRCm39) E670G probably benign Het
Notch4 A G 17: 34,784,601 (GRCm39) T101A probably benign Het
Or10a49 T C 7: 108,467,563 (GRCm39) Y266C probably damaging Het
Or2t35 T A 14: 14,407,963 (GRCm38) I245K probably benign Het
Or5b123 G A 19: 13,597,365 (GRCm39) V237I probably benign Het
P2rx2 T C 5: 110,488,172 (GRCm39) T461A probably benign Het
Pank1 G A 19: 34,799,194 (GRCm39) T419I probably damaging Het
Patz1 T C 11: 3,244,562 (GRCm39) V481A unknown Het
Pdlim5 A G 3: 142,018,058 (GRCm39) L179P probably benign Het
Pik3ap1 A T 19: 41,296,967 (GRCm39) V461D probably damaging Het
Polq T C 16: 36,848,176 (GRCm39) V261A probably damaging Het
Ppm1a G A 12: 72,837,451 (GRCm39) V333M possibly damaging Het
R3hcc1l T C 19: 42,552,671 (GRCm39) L556P probably benign Het
Rabggta G A 14: 55,956,375 (GRCm39) Q365* probably null Het
Ranbp9 T C 13: 43,578,519 (GRCm39) T185A probably benign Het
Rd3l T G 12: 111,945,913 (GRCm39) N189H probably damaging Het
Rnf17 A G 14: 56,722,636 (GRCm39) T1066A probably damaging Het
Rnf213 G A 11: 119,332,794 (GRCm39) A2669T Het
Ros1 T A 10: 51,996,931 (GRCm39) H1268L probably benign Het
Rps6ka4 G T 19: 6,809,354 (GRCm39) S433R possibly damaging Het
Ryr1 A G 7: 28,759,092 (GRCm39) L3362P probably damaging Het
Setd1b A T 5: 123,298,046 (GRCm39) T1361S unknown Het
Setd2 T C 9: 110,377,570 (GRCm39) S462P probably damaging Het
Sgsm3 A T 15: 80,890,935 (GRCm39) Q132L probably benign Het
Slx1b C A 7: 126,291,698 (GRCm39) R122L probably damaging Het
Sorbs2 A T 8: 46,276,788 (GRCm39) T1167S probably benign Het
Spdya A C 17: 71,869,513 (GRCm39) T103P probably damaging Het
Stfa2 A G 16: 36,228,638 (GRCm39) S20P probably benign Het
Sulf1 A G 1: 12,891,026 (GRCm39) T400A probably benign Het
Tardbp A T 4: 148,709,751 (GRCm39) D23E probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tgm1 C T 14: 55,948,441 (GRCm39) D237N probably benign Het
Tgs1 T A 4: 3,585,964 (GRCm39) N280K probably benign Het
Tmem198 A T 1: 75,459,272 (GRCm39) I76F possibly damaging Het
Trpv2 A T 11: 62,475,385 (GRCm39) Y266F probably damaging Het
Ttn C T 2: 76,569,845 (GRCm39) G27016E probably damaging Het
Ttn T C 2: 76,781,824 (GRCm39) E1074G unknown Het
Unc5b A T 10: 60,613,322 (GRCm39) W305R probably damaging Het
Usp38 A G 8: 81,741,164 (GRCm39) probably benign Het
Vmn1r79 A G 7: 11,910,582 (GRCm39) T155A probably benign Het
Vwce G A 19: 10,615,481 (GRCm39) V121I probably benign Het
Wdr91 A T 6: 34,865,961 (GRCm39) D530E probably benign Het
Wnt4 A G 4: 137,023,929 (GRCm39) T299A probably benign Het
Yeats2 T A 16: 20,047,491 (GRCm39) Y1284* probably null Het
Zfp113 A T 5: 138,148,888 (GRCm39) Y85* probably null Het
Zfp184 A G 13: 22,144,096 (GRCm39) T601A probably benign Het
Zfp655 A G 5: 145,180,442 (GRCm39) E100G probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca3a2 APN 3 144,804,574 (GRCm39) missense probably damaging 1.00
IGL01019:Clca3a2 APN 3 144,519,388 (GRCm39) nonsense probably null
IGL01337:Clca3a2 APN 3 144,800,939 (GRCm39) missense probably damaging 1.00
IGL01389:Clca3a2 APN 3 144,783,629 (GRCm39) critical splice donor site probably null
IGL01595:Clca3a2 APN 3 144,793,768 (GRCm39) missense probably damaging 1.00
IGL01663:Clca3a2 APN 3 144,522,916 (GRCm39) missense probably damaging 0.97
IGL01704:Clca3a2 APN 3 144,800,979 (GRCm39) missense probably benign 0.04
IGL01779:Clca3a2 APN 3 144,525,139 (GRCm39) missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144,519,216 (GRCm39) missense probably benign
IGL02301:Clca3a2 APN 3 144,512,133 (GRCm39) missense probably damaging 0.98
IGL02416:Clca3a2 APN 3 144,790,777 (GRCm39) missense probably benign 0.02
IGL02455:Clca3a2 APN 3 144,787,172 (GRCm39) missense probably benign 0.00
IGL02481:Clca3a2 APN 3 144,790,701 (GRCm39) missense possibly damaging 0.92
IGL02526:Clca3a2 APN 3 144,793,779 (GRCm39) missense probably benign 0.02
IGL02619:Clca3a2 APN 3 144,512,083 (GRCm39) missense probably damaging 1.00
IGL02797:Clca3a2 APN 3 144,787,024 (GRCm39) missense probably benign 0.02
IGL02852:Clca3a2 APN 3 144,512,104 (GRCm39) missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144,522,529 (GRCm39) missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144,512,177 (GRCm39) missense probably damaging 1.00
IGL03253:Clca3a2 APN 3 144,777,324 (GRCm39) missense probably benign 0.41
IGL03256:Clca3a2 APN 3 144,792,153 (GRCm39) missense possibly damaging 0.75
IGL03294:Clca3a2 APN 3 144,803,530 (GRCm39) missense probably damaging 1.00
3370:Clca3a2 UTSW 3 144,783,738 (GRCm39) missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144,522,494 (GRCm39) missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144,519,659 (GRCm39) missense possibly damaging 0.90
R0479:Clca3a2 UTSW 3 144,796,610 (GRCm39) missense probably damaging 1.00
R0542:Clca3a2 UTSW 3 144,781,571 (GRCm39) splice site probably benign
R0629:Clca3a2 UTSW 3 144,778,000 (GRCm39) missense probably benign
R1249:Clca3a2 UTSW 3 144,508,765 (GRCm39) missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144,519,624 (GRCm39) splice site probably benign
R1488:Clca3a2 UTSW 3 144,789,925 (GRCm39) missense possibly damaging 0.49
R1523:Clca3a2 UTSW 3 144,777,405 (GRCm39) nonsense probably null
R1568:Clca3a2 UTSW 3 144,781,410 (GRCm39) nonsense probably null
R1586:Clca3a2 UTSW 3 144,516,477 (GRCm39) missense possibly damaging 0.94
R1650:Clca3a2 UTSW 3 144,797,973 (GRCm39) missense probably damaging 1.00
R1771:Clca3a2 UTSW 3 144,787,171 (GRCm39) missense probably benign 0.12
R1776:Clca3a2 UTSW 3 144,519,681 (GRCm39) missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144,512,164 (GRCm39) missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144,516,457 (GRCm39) missense probably benign
R1923:Clca3a2 UTSW 3 144,511,491 (GRCm39) missense probably damaging 1.00
R2101:Clca3a2 UTSW 3 144,783,699 (GRCm39) missense probably damaging 0.99
R2200:Clca3a2 UTSW 3 144,519,685 (GRCm39) missense probably benign 0.10
R2242:Clca3a2 UTSW 3 144,796,551 (GRCm39) missense probably damaging 0.98
R2324:Clca3a2 UTSW 3 144,512,041 (GRCm39) critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144,519,679 (GRCm39) missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144,512,088 (GRCm39) missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144,514,522 (GRCm39) unclassified probably benign
R3551:Clca3a2 UTSW 3 144,508,842 (GRCm39) missense probably damaging 1.00
R3751:Clca3a2 UTSW 3 144,777,216 (GRCm39) missense probably benign 0.04
R3952:Clca3a2 UTSW 3 144,508,822 (GRCm39) missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144,512,081 (GRCm39) missense probably benign 0.02
R4496:Clca3a2 UTSW 3 144,797,926 (GRCm39) missense possibly damaging 0.94
R4518:Clca3a2 UTSW 3 144,514,466 (GRCm39) missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144,511,444 (GRCm39) missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144,523,692 (GRCm39) missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144,512,263 (GRCm39) missense probably damaging 1.00
R4962:Clca3a2 UTSW 3 144,783,640 (GRCm39) missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144,512,104 (GRCm39) missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144,511,599 (GRCm39) missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R5344:Clca3a2 UTSW 3 144,793,703 (GRCm39) missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144,503,286 (GRCm39) missense probably benign 0.00
R5424:Clca3a2 UTSW 3 144,789,942 (GRCm39) missense probably damaging 0.99
R5656:Clca3a2 UTSW 3 144,503,393 (GRCm39) missense probably benign 0.26
R5931:Clca3a2 UTSW 3 144,797,886 (GRCm39) missense possibly damaging 0.88
R6059:Clca3a2 UTSW 3 144,516,531 (GRCm39) missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144,525,118 (GRCm39) missense probably damaging 0.99
R6181:Clca3a2 UTSW 3 144,796,469 (GRCm39) nonsense probably null
R6254:Clca3a2 UTSW 3 144,507,895 (GRCm39) missense probably benign
R6336:Clca3a2 UTSW 3 144,512,239 (GRCm39) missense probably benign
R6470:Clca3a2 UTSW 3 144,510,024 (GRCm39) splice site probably null
R6593:Clca3a2 UTSW 3 144,514,338 (GRCm39) critical splice donor site probably null
R6598:Clca3a2 UTSW 3 144,792,246 (GRCm39) nonsense probably null
R6631:Clca3a2 UTSW 3 144,519,405 (GRCm39) missense probably benign
R6826:Clca3a2 UTSW 3 144,523,815 (GRCm39) missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144,512,144 (GRCm39) missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144,514,462 (GRCm39) missense probably damaging 1.00
R7167:Clca3a2 UTSW 3 144,803,545 (GRCm39) missense probably benign 0.40
R7211:Clca3a2 UTSW 3 144,519,775 (GRCm39) missense probably benign 0.00
R7229:Clca3a2 UTSW 3 144,789,869 (GRCm39) missense probably damaging 1.00
R7256:Clca3a2 UTSW 3 144,796,608 (GRCm39) missense probably damaging 0.99
R7324:Clca3a2 UTSW 3 144,514,372 (GRCm39) missense probably damaging 0.99
R7365:Clca3a2 UTSW 3 144,804,545 (GRCm39) missense probably damaging 1.00
R7411:Clca3a2 UTSW 3 144,507,860 (GRCm39) missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144,503,362 (GRCm39) missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144,507,674 (GRCm39) makesense probably null
R7813:Clca3a2 UTSW 3 144,790,726 (GRCm39) missense probably benign 0.26
R7889:Clca3a2 UTSW 3 144,516,574 (GRCm39) nonsense probably null
R7946:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144,519,756 (GRCm39) missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144,511,527 (GRCm39) missense probably damaging 1.00
R8077:Clca3a2 UTSW 3 144,777,288 (GRCm39) missense possibly damaging 0.56
R8169:Clca3a2 UTSW 3 144,783,653 (GRCm39) missense probably damaging 1.00
R8290:Clca3a2 UTSW 3 144,793,719 (GRCm39) missense possibly damaging 0.93
R8300:Clca3a2 UTSW 3 144,804,692 (GRCm39) missense probably benign 0.00
R8344:Clca3a2 UTSW 3 144,511,703 (GRCm39) critical splice acceptor site probably null
R8350:Clca3a2 UTSW 3 144,783,668 (GRCm39) missense probably benign 0.19
R8367:Clca3a2 UTSW 3 144,523,508 (GRCm39) splice site probably null
R8371:Clca3a2 UTSW 3 144,513,114 (GRCm39) nonsense probably null
R8814:Clca3a2 UTSW 3 144,503,525 (GRCm39) missense probably benign 0.18
R8854:Clca3a2 UTSW 3 144,783,852 (GRCm39) missense possibly damaging 0.94
R8876:Clca3a2 UTSW 3 144,777,360 (GRCm39) missense probably benign 0.00
R8887:Clca3a2 UTSW 3 144,790,810 (GRCm39) nonsense probably null
R9006:Clca3a2 UTSW 3 144,783,789 (GRCm39) missense probably damaging 0.99
R9031:Clca3a2 UTSW 3 144,511,475 (GRCm39) missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144,519,447 (GRCm39) splice site probably benign
R9093:Clca3a2 UTSW 3 144,781,481 (GRCm39) missense probably benign 0.20
R9190:Clca3a2 UTSW 3 144,796,599 (GRCm39) missense probably benign 0.00
R9201:Clca3a2 UTSW 3 144,519,684 (GRCm39) missense probably benign 0.00
R9209:Clca3a2 UTSW 3 144,778,005 (GRCm39) missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144,525,158 (GRCm39) missense probably benign
R9469:Clca3a2 UTSW 3 144,507,938 (GRCm39) missense probably damaging 1.00
R9501:Clca3a2 UTSW 3 144,777,322 (GRCm39) nonsense probably null
R9515:Clca3a2 UTSW 3 144,508,808 (GRCm39) nonsense probably null
R9569:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
X0025:Clca3a2 UTSW 3 144,792,265 (GRCm39) missense possibly damaging 0.87
Z1177:Clca3a2 UTSW 3 144,792,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACCAGCTTCATTGTATGCCTG -3'
(R):5'- GCTTTTCTGTGATTTTGAAAACTGGAC -3'

Sequencing Primer
(F):5'- ATGCCTGGATTGCAATGTAGAGC -3'
(R):5'- CTGGACATTTGTTTGTCAATAATTGC -3'
Posted On 2022-11-14