Incidental Mutation 'R9664:Clca3a2'
ID 735596
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9664 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144797814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 792 (Y792N)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably damaging
Transcript: ENSMUST00000029929
AA Change: Y792N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: Y792N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 G A 15: 76,594,183 D277N probably damaging Het
Adgrv1 A T 13: 81,522,169 S2353T probably benign Het
Adgrv1 A T 13: 81,595,252 N43K probably damaging Het
Adnp2 A G 18: 80,142,722 I12T probably damaging Het
Ahnak2 A G 12: 112,774,929 L903P probably damaging Het
Ankhd1 T G 18: 36,647,825 S1977A probably benign Het
Ap1m2 T C 9: 21,305,687 M118V probably benign Het
Ap3d1 T C 10: 80,712,805 K846R possibly damaging Het
Aqr C A 2: 114,140,915 E480* probably null Het
Arl6 G T 16: 59,613,836 Q182K probably benign Het
Arpc2 A G 1: 74,254,875 K106E probably benign Het
Atp8a1 A C 5: 67,732,181 F599V Het
B3galt5 A T 16: 96,316,003 I279F probably damaging Het
Calcoco2 G T 11: 96,100,278 A211D unknown Het
Ccdc33 T C 9: 58,086,572 E342G possibly damaging Het
Ccdc88a C A 11: 29,455,484 Q386K probably benign Het
Cdh20 A G 1: 104,934,340 K82E probably benign Het
Col6a6 T C 9: 105,781,055 I653V probably benign Het
Col7a1 C T 9: 108,983,581 R2826W unknown Het
D6Ertd527e A G 6: 87,111,926 N357S unknown Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dnajc6 A G 4: 101,618,624 N565D probably benign Het
Doc2g A G 19: 4,004,390 Y155C probably damaging Het
Dot1l G A 10: 80,788,527 G943D probably damaging Het
Dst T C 1: 34,181,655 V2180A probably benign Het
Eftud2 A C 11: 102,868,596 Y160* probably null Het
Ehd1 A T 19: 6,281,232 Q140L probably benign Het
Etv3 T C 3: 87,535,865 V252A probably benign Het
F11 A T 8: 45,241,529 C598* probably null Het
Fancm T A 12: 65,090,984 N316K probably benign Het
Flnc T C 6: 29,457,215 V2372A probably damaging Het
Fry A G 5: 150,359,023 R338G probably damaging Het
Gfra3 T C 18: 34,704,538 T136A probably benign Het
Golga7b T C 19: 42,267,023 V113A possibly damaging Het
Gpn3 G T 5: 122,382,243 V102L Het
Herc2 A G 7: 56,170,590 N2859S possibly damaging Het
Hpd A T 5: 123,180,885 probably null Het
Hspg2 C T 4: 137,539,576 T1964I probably benign Het
Hydin A T 8: 110,494,333 T1454S probably benign Het
Irgm2 A T 11: 58,220,046 T188S possibly damaging Het
Jak3 A G 8: 71,678,722 D77G probably damaging Het
Kcnj4 G T 15: 79,485,019 F253L possibly damaging Het
Kidins220 T A 12: 25,056,896 D1358E probably benign Het
Klf1 C A 8: 84,903,432 C295* probably null Het
Kmt2a C T 9: 44,848,805 W582* probably null Het
Lrig2 A G 3: 104,464,240 C716R probably damaging Het
Lrp1b C T 2: 40,874,992 D2941N Het
Lrpprc A T 17: 84,712,834 V1141E probably damaging Het
Mrgprx1 C T 7: 48,021,525 G158D probably benign Het
Muc5b C A 7: 141,855,542 A1121D unknown Het
Nf1 G T 11: 79,443,907 V852L probably damaging Het
Nlrp5 A G 7: 23,418,861 E670G probably benign Het
Notch4 A G 17: 34,565,627 T101A probably benign Het
Olfr1487 G A 19: 13,620,001 V237I probably benign Het
Olfr517 T C 7: 108,868,356 Y266C probably damaging Het
Olfr721-ps1 T A 14: 14,407,963 I245K probably benign Het
P2rx2 T C 5: 110,340,306 T461A probably benign Het
Pank1 G A 19: 34,821,794 T419I probably damaging Het
Patz1 T C 11: 3,294,562 V481A unknown Het
Pdlim5 A G 3: 142,312,297 L179P probably benign Het
Pik3ap1 A T 19: 41,308,528 V461D probably damaging Het
Polq T C 16: 37,027,814 V261A probably damaging Het
Ppm1a G A 12: 72,790,677 V333M possibly damaging Het
R3hcc1l T C 19: 42,564,232 L556P probably benign Het
Rabggta G A 14: 55,718,918 Q365* probably null Het
Ranbp9 T C 13: 43,425,043 T185A probably benign Het
Rd3l T G 12: 111,979,479 N189H probably damaging Het
Rnf17 A G 14: 56,485,179 T1066A probably damaging Het
Rnf213 G A 11: 119,441,968 A2669T Het
Ros1 T A 10: 52,120,835 H1268L probably benign Het
Rps6ka4 G T 19: 6,831,986 S433R possibly damaging Het
Ryr1 A G 7: 29,059,667 L3362P probably damaging Het
Setd1b A T 5: 123,159,983 T1361S unknown Het
Setd2 T C 9: 110,548,502 S462P probably damaging Het
Sgsm3 A T 15: 81,006,734 Q132L probably benign Het
Slx1b C A 7: 126,692,526 R122L probably damaging Het
Sorbs2 A T 8: 45,823,751 T1167S probably benign Het
Spdya A C 17: 71,562,518 T103P probably damaging Het
Stfa2 A G 16: 36,408,276 S20P probably benign Het
Sulf1 A G 1: 12,820,802 T400A probably benign Het
Tardbp A T 4: 148,625,294 D23E probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tgm1 C T 14: 55,710,984 D237N probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tmem198 A T 1: 75,482,628 I76F possibly damaging Het
Trpv2 A T 11: 62,584,559 Y266F probably damaging Het
Ttn C T 2: 76,739,501 G27016E probably damaging Het
Ttn T C 2: 76,951,480 E1074G unknown Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Usp38 A G 8: 81,014,535 probably benign Het
Vmn1r79 A G 7: 12,176,655 T155A probably benign Het
Vwce G A 19: 10,638,117 V121I probably benign Het
Wdr63 T C 3: 146,042,839 N840S probably benign Het
Wdr91 A T 6: 34,889,026 D530E probably benign Het
Wnt4 A G 4: 137,296,618 T299A probably benign Het
Yeats2 T A 16: 20,228,741 Y1284* probably null Het
Zfp113 A T 5: 138,150,626 Y85* probably null Het
Zfp184 A G 13: 21,959,926 T601A probably benign Het
Zfp655 A G 5: 145,243,632 E100G probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144813686 splice site probably benign
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGACCAGCTTCATTGTATGCCTG -3'
(R):5'- GCTTTTCTGTGATTTTGAAAACTGGAC -3'

Sequencing Primer
(F):5'- ATGCCTGGATTGCAATGTAGAGC -3'
(R):5'- CTGGACATTTGTTTGTCAATAATTGC -3'
Posted On 2022-11-14