Incidental Mutation 'R9664:Eftud2'
ID 735645
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9664 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102729299-102771811 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 102759422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 160 (Y160*)
Ref Sequence ENSEMBL: ENSMUSP00000102675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000138483] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably null
Transcript: ENSMUST00000021306
AA Change: Y161*
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: Y161*

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107060
AA Change: Y160*
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: Y160*

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138483
Predicted Effect probably null
Transcript: ENSMUST00000173679
AA Change: Y151*
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: Y151*

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 G A 15: 76,478,383 (GRCm39) D277N probably damaging Het
Adgrv1 A T 13: 81,670,288 (GRCm39) S2353T probably benign Het
Adgrv1 A T 13: 81,743,371 (GRCm39) N43K probably damaging Het
Adnp2 A G 18: 80,185,937 (GRCm39) I12T probably damaging Het
Ahnak2 A G 12: 112,741,363 (GRCm39) L903P probably damaging Het
Ankhd1 T G 18: 36,780,878 (GRCm39) S1977A probably benign Het
Ap1m2 T C 9: 21,216,983 (GRCm39) M118V probably benign Het
Ap3d1 T C 10: 80,548,639 (GRCm39) K846R possibly damaging Het
Aqr C A 2: 113,971,396 (GRCm39) E480* probably null Het
Arl6 G T 16: 59,434,199 (GRCm39) Q182K probably benign Het
Arpc2 A G 1: 74,294,034 (GRCm39) K106E probably benign Het
Atp8a1 A C 5: 67,889,524 (GRCm39) F599V Het
B3galt5 A T 16: 96,117,203 (GRCm39) I279F probably damaging Het
Calcoco2 G T 11: 95,991,104 (GRCm39) A211D unknown Het
Ccdc33 T C 9: 57,993,855 (GRCm39) E342G possibly damaging Het
Ccdc88a C A 11: 29,405,484 (GRCm39) Q386K probably benign Het
Cdh20 A G 1: 104,862,065 (GRCm39) K82E probably benign Het
Clca3a2 A T 3: 144,503,575 (GRCm39) Y792N probably damaging Het
Col6a6 T C 9: 105,658,254 (GRCm39) I653V probably benign Het
Col7a1 C T 9: 108,812,649 (GRCm39) R2826W unknown Het
D6Ertd527e A G 6: 87,088,908 (GRCm39) N357S unknown Het
Dmgdh T A 13: 93,857,123 (GRCm39) N742K probably benign Het
Dnai3 T C 3: 145,748,594 (GRCm39) N840S probably benign Het
Dnajc6 A G 4: 101,475,821 (GRCm39) N565D probably benign Het
Doc2g A G 19: 4,054,390 (GRCm39) Y155C probably damaging Het
Dot1l G A 10: 80,624,361 (GRCm39) G943D probably damaging Het
Dst T C 1: 34,220,736 (GRCm39) V2180A probably benign Het
Ehd1 A T 19: 6,331,262 (GRCm39) Q140L probably benign Het
Etv3 T C 3: 87,443,172 (GRCm39) V252A probably benign Het
F11 A T 8: 45,694,566 (GRCm39) C598* probably null Het
Fancm T A 12: 65,137,758 (GRCm39) N316K probably benign Het
Flnc T C 6: 29,457,214 (GRCm39) V2372A probably damaging Het
Fry A G 5: 150,282,488 (GRCm39) R338G probably damaging Het
Gfra3 T C 18: 34,837,591 (GRCm39) T136A probably benign Het
Golga7b T C 19: 42,255,462 (GRCm39) V113A possibly damaging Het
Gpn3 G T 5: 122,520,306 (GRCm39) V102L Het
Herc2 A G 7: 55,820,338 (GRCm39) N2859S possibly damaging Het
Hpd A T 5: 123,318,948 (GRCm39) probably null Het
Hspg2 C T 4: 137,266,887 (GRCm39) T1964I probably benign Het
Hydin A T 8: 111,220,965 (GRCm39) T1454S probably benign Het
Irgm2 A T 11: 58,110,872 (GRCm39) T188S possibly damaging Het
Jak3 A G 8: 72,131,366 (GRCm39) D77G probably damaging Het
Kcnj4 G T 15: 79,369,220 (GRCm39) F253L possibly damaging Het
Kidins220 T A 12: 25,106,895 (GRCm39) D1358E probably benign Het
Klf1 C A 8: 85,630,061 (GRCm39) C295* probably null Het
Kmt2a C T 9: 44,760,102 (GRCm39) W582* probably null Het
Lrig2 A G 3: 104,371,556 (GRCm39) C716R probably damaging Het
Lrp1b C T 2: 40,765,004 (GRCm39) D2941N Het
Lrpprc A T 17: 85,020,262 (GRCm39) V1141E probably damaging Het
Mrgprx1 C T 7: 47,671,273 (GRCm39) G158D probably benign Het
Muc5b C A 7: 141,409,279 (GRCm39) A1121D unknown Het
Nf1 G T 11: 79,334,733 (GRCm39) V852L probably damaging Het
Nlrp5 A G 7: 23,118,286 (GRCm39) E670G probably benign Het
Notch4 A G 17: 34,784,601 (GRCm39) T101A probably benign Het
Or10a49 T C 7: 108,467,563 (GRCm39) Y266C probably damaging Het
Or2t35 T A 14: 14,407,963 (GRCm38) I245K probably benign Het
Or5b123 G A 19: 13,597,365 (GRCm39) V237I probably benign Het
P2rx2 T C 5: 110,488,172 (GRCm39) T461A probably benign Het
Pank1 G A 19: 34,799,194 (GRCm39) T419I probably damaging Het
Patz1 T C 11: 3,244,562 (GRCm39) V481A unknown Het
Pdlim5 A G 3: 142,018,058 (GRCm39) L179P probably benign Het
Pik3ap1 A T 19: 41,296,967 (GRCm39) V461D probably damaging Het
Polq T C 16: 36,848,176 (GRCm39) V261A probably damaging Het
Ppm1a G A 12: 72,837,451 (GRCm39) V333M possibly damaging Het
R3hcc1l T C 19: 42,552,671 (GRCm39) L556P probably benign Het
Rabggta G A 14: 55,956,375 (GRCm39) Q365* probably null Het
Ranbp9 T C 13: 43,578,519 (GRCm39) T185A probably benign Het
Rd3l T G 12: 111,945,913 (GRCm39) N189H probably damaging Het
Rnf17 A G 14: 56,722,636 (GRCm39) T1066A probably damaging Het
Rnf213 G A 11: 119,332,794 (GRCm39) A2669T Het
Ros1 T A 10: 51,996,931 (GRCm39) H1268L probably benign Het
Rps6ka4 G T 19: 6,809,354 (GRCm39) S433R possibly damaging Het
Ryr1 A G 7: 28,759,092 (GRCm39) L3362P probably damaging Het
Setd1b A T 5: 123,298,046 (GRCm39) T1361S unknown Het
Setd2 T C 9: 110,377,570 (GRCm39) S462P probably damaging Het
Sgsm3 A T 15: 80,890,935 (GRCm39) Q132L probably benign Het
Slx1b C A 7: 126,291,698 (GRCm39) R122L probably damaging Het
Sorbs2 A T 8: 46,276,788 (GRCm39) T1167S probably benign Het
Spdya A C 17: 71,869,513 (GRCm39) T103P probably damaging Het
Stfa2 A G 16: 36,228,638 (GRCm39) S20P probably benign Het
Sulf1 A G 1: 12,891,026 (GRCm39) T400A probably benign Het
Tardbp A T 4: 148,709,751 (GRCm39) D23E probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tgm1 C T 14: 55,948,441 (GRCm39) D237N probably benign Het
Tgs1 T A 4: 3,585,964 (GRCm39) N280K probably benign Het
Tmem198 A T 1: 75,459,272 (GRCm39) I76F possibly damaging Het
Trpv2 A T 11: 62,475,385 (GRCm39) Y266F probably damaging Het
Ttn C T 2: 76,569,845 (GRCm39) G27016E probably damaging Het
Ttn T C 2: 76,781,824 (GRCm39) E1074G unknown Het
Unc5b A T 10: 60,613,322 (GRCm39) W305R probably damaging Het
Usp38 A G 8: 81,741,164 (GRCm39) probably benign Het
Vmn1r79 A G 7: 11,910,582 (GRCm39) T155A probably benign Het
Vwce G A 19: 10,615,481 (GRCm39) V121I probably benign Het
Wdr91 A T 6: 34,865,961 (GRCm39) D530E probably benign Het
Wnt4 A G 4: 137,023,929 (GRCm39) T299A probably benign Het
Yeats2 T A 16: 20,047,491 (GRCm39) Y1284* probably null Het
Zfp113 A T 5: 138,148,888 (GRCm39) Y85* probably null Het
Zfp184 A G 13: 22,144,096 (GRCm39) T601A probably benign Het
Zfp655 A G 5: 145,180,442 (GRCm39) E100G probably damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102,756,389 (GRCm39) splice site probably benign
IGL01765:Eftud2 APN 11 102,730,082 (GRCm39) missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102,759,953 (GRCm39) missense probably benign 0.08
IGL02161:Eftud2 APN 11 102,745,702 (GRCm39) splice site probably benign
IGL02165:Eftud2 APN 11 102,742,573 (GRCm39) splice site probably benign
IGL02218:Eftud2 APN 11 102,761,039 (GRCm39) missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102,742,580 (GRCm39) splice site probably null
IGL02664:Eftud2 APN 11 102,732,538 (GRCm39) missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102,737,440 (GRCm39) missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102,761,082 (GRCm39) splice site probably benign
IGL02870:Eftud2 APN 11 102,753,452 (GRCm39) missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102,761,009 (GRCm39) missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102,759,443 (GRCm39) missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102,755,551 (GRCm39) missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102,755,627 (GRCm39) splice site probably benign
R0463:Eftud2 UTSW 11 102,755,597 (GRCm39) missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102,735,048 (GRCm39) missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102,737,446 (GRCm39) missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102,740,010 (GRCm39) missense probably benign
R1079:Eftud2 UTSW 11 102,730,870 (GRCm39) nonsense probably null
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1220:Eftud2 UTSW 11 102,742,573 (GRCm39) splice site probably benign
R1438:Eftud2 UTSW 11 102,750,868 (GRCm39) missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102,730,266 (GRCm39) missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102,745,597 (GRCm39) splice site probably benign
R2270:Eftud2 UTSW 11 102,755,607 (GRCm39) missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102,735,006 (GRCm39) missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102,732,289 (GRCm39) splice site probably null
R3892:Eftud2 UTSW 11 102,737,013 (GRCm39) missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102,750,936 (GRCm39) missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102,730,242 (GRCm39) splice site probably null
R4794:Eftud2 UTSW 11 102,761,003 (GRCm39) missense probably benign 0.14
R4841:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102,758,670 (GRCm39) critical splice donor site probably null
R5208:Eftud2 UTSW 11 102,732,011 (GRCm39) missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102,730,883 (GRCm39) missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102,755,606 (GRCm39) missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102,729,449 (GRCm39) nonsense probably null
R7604:Eftud2 UTSW 11 102,738,838 (GRCm39) missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102,730,934 (GRCm39) missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8019:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8139:Eftud2 UTSW 11 102,758,685 (GRCm39) missense probably benign 0.04
R8431:Eftud2 UTSW 11 102,737,062 (GRCm39) missense probably benign 0.08
R8545:Eftud2 UTSW 11 102,731,097 (GRCm39) missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102,759,447 (GRCm39) missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102,759,971 (GRCm39) missense probably benign
R9173:Eftud2 UTSW 11 102,734,242 (GRCm39) missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102,750,855 (GRCm39) missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102,730,262 (GRCm39) missense probably benign 0.03
R9604:Eftud2 UTSW 11 102,737,056 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GATCCCAAATGCAGAACGGATC -3'
(R):5'- GTGTTAATCCTTTGCTGTCCCATAG -3'

Sequencing Primer
(F):5'- CGGATCACCTAAAAATAATGCAGG -3'
(R):5'- AATCCTTTGCTGTCCCATAGTTCTC -3'
Posted On 2022-11-14