Incidental Mutation 'R9666:Tln1'
ID 735698
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9666 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43542957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1344 (D1344G)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: D1344G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: D1344G

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C A 12: 118,838,422 (GRCm39) V1047L probably damaging Het
Akap6 G A 12: 53,188,318 (GRCm39) A1911T probably benign Het
Ank2 T A 3: 126,726,838 (GRCm39) K819* probably null Het
Apc2 A G 10: 80,147,183 (GRCm39) R746G possibly damaging Het
Baz1a A G 12: 54,988,345 (GRCm39) I268T probably benign Het
Bysl A G 17: 47,914,865 (GRCm39) I206T probably benign Het
Ccdc70 A C 8: 22,463,357 (GRCm39) E49A possibly damaging Het
Chd1 A T 17: 15,955,976 (GRCm39) H525L probably damaging Het
Col4a4 T C 1: 82,496,670 (GRCm39) E442G unknown Het
Cpd G A 11: 76,693,133 (GRCm39) P718S probably benign Het
Dip2b T A 15: 100,107,461 (GRCm39) I1391N probably damaging Het
Dpp9 T C 17: 56,501,946 (GRCm39) T541A probably damaging Het
Dst C T 1: 34,218,947 (GRCm39) Q1796* probably null Het
Gm10267 T C 18: 44,291,397 (GRCm39) I25V probably benign Het
Gm32742 C T 9: 51,061,441 (GRCm39) R744Q probably benign Het
Gm37240 T C 3: 84,422,952 (GRCm39) Y139C probably damaging Het
Gm39115 A G 7: 141,689,255 (GRCm39) C173R unknown Het
Grm6 T G 11: 50,750,877 (GRCm39) V680G probably damaging Het
Grxcr2 C T 18: 42,131,956 (GRCm39) D38N probably damaging Het
Iah1 G A 12: 21,366,587 (GRCm39) R52H probably damaging Het
Ift43 A G 12: 86,131,920 (GRCm39) Y36C possibly damaging Het
Igf2r T C 17: 12,945,588 (GRCm39) I334V probably benign Het
Igfn1 T A 1: 135,897,692 (GRCm39) Q958L possibly damaging Het
Il4i1 G A 7: 44,489,263 (GRCm39) A343T possibly damaging Het
Ints1 T C 5: 139,748,217 (GRCm39) I1128V probably benign Het
Irx1 C A 13: 72,111,588 (GRCm39) G7V probably damaging Het
Krr1 A G 10: 111,818,896 (GRCm39) R312G possibly damaging Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,389,857 (GRCm39) probably null Het
Lpin2 A T 17: 71,529,065 (GRCm39) N108Y probably damaging Het
Man2a1 A T 17: 64,943,557 (GRCm39) E204V possibly damaging Het
Megf8 A G 7: 25,030,166 (GRCm39) T434A possibly damaging Het
Minar1 A T 9: 89,484,072 (GRCm39) S442T probably benign Het
Muc16 T C 9: 18,567,285 (GRCm39) T1745A unknown Het
Mycbp2 G T 14: 103,371,474 (GRCm39) P4135T probably damaging Het
Nuggc T C 14: 65,857,045 (GRCm39) V398A possibly damaging Het
Or1e22 A G 11: 73,376,885 (GRCm39) I255T probably damaging Het
Or1e29 A T 11: 73,667,976 (GRCm39) M59K probably damaging Het
Or5w11 C T 2: 87,459,152 (GRCm39) A115V possibly damaging Het
Or6a2 A T 7: 106,600,099 (GRCm39) S323T probably benign Het
Or6e1 G T 14: 54,520,342 (GRCm39) N3K probably damaging Het
Or6f1 A G 7: 85,970,444 (GRCm39) S239P probably damaging Het
Parg A G 14: 31,964,294 (GRCm39) N653S probably damaging Het
Plek A G 11: 16,945,346 (GRCm39) F18L probably benign Het
Pnoc A G 14: 65,639,247 (GRCm39) I206T possibly damaging Het
Ppp4r3a T C 12: 101,049,129 (GRCm39) M1V probably null Het
Pramel21 A G 4: 143,341,699 (GRCm39) T43A probably benign Het
Psg22 T C 7: 18,458,248 (GRCm39) V313A probably benign Het
Ptk2b G T 14: 66,409,546 (GRCm39) P497T probably damaging Het
Rer1 A G 4: 155,160,044 (GRCm39) probably null Het
Rnf130 A G 11: 49,986,618 (GRCm39) T321A probably benign Het
Rnf207 A T 4: 152,397,717 (GRCm39) F346I probably damaging Het
Rraga T A 4: 86,494,574 (GRCm39) I140N possibly damaging Het
Rusc2 A T 4: 43,416,262 (GRCm39) M523L probably benign Het
Sh3bp1 T A 15: 78,792,622 (GRCm39) V495D probably benign Het
Slc44a5 T C 3: 153,945,926 (GRCm39) L153P probably benign Het
Spag16 T C 1: 70,764,072 (GRCm39) S631P probably damaging Het
Syne1 A C 10: 4,984,937 (GRCm39) L747R probably damaging Het
Tac1 A G 6: 7,555,675 (GRCm39) E21G probably benign Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tnc C T 4: 63,926,045 (GRCm39) E912K probably damaging Het
Trav16d-dv11 A G 14: 53,285,037 (GRCm39) T38A probably benign Het
Trbv15 T A 6: 41,118,364 (GRCm39) L40Q probably damaging Het
Trpa1 T C 1: 14,973,455 (GRCm39) I288V possibly damaging Het
Ttn A T 2: 76,604,941 (GRCm39) I18331N probably damaging Het
Tubgcp2 A T 7: 139,587,836 (GRCm39) I263N probably damaging Het
Ugt8a T C 3: 125,708,957 (GRCm39) H51R probably benign Het
Vmn2r2 T C 3: 64,023,870 (GRCm39) T904A probably benign Het
Zfp575 G A 7: 24,285,323 (GRCm39) T106M probably damaging Het
Zfp617 A G 8: 72,686,539 (GRCm39) T290A probably benign Het
Zfp809 T C 9: 22,149,863 (GRCm39) V120A probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm39) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm39) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm39) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm39) missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43,542,893 (GRCm39) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GATTCTCCAGGAGTTCTCGGAC -3'
(R):5'- CAACCTCAAGAGTCAGCTGG -3'

Sequencing Primer
(F):5'- CCAGGAGTTCTCGGACTGTCTG -3'
(R):5'- CTGCCCGGTAAGCTGGAAAG -3'
Posted On 2022-11-14