Incidental Mutation 'R9666:Abcb5'
ID 735736
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R9666 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 118838422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1047 (V1047L)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect probably damaging
Transcript: ENSMUST00000035515
AA Change: V1047L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: V1047L

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,188,318 (GRCm39) A1911T probably benign Het
Ank2 T A 3: 126,726,838 (GRCm39) K819* probably null Het
Apc2 A G 10: 80,147,183 (GRCm39) R746G possibly damaging Het
Baz1a A G 12: 54,988,345 (GRCm39) I268T probably benign Het
Bysl A G 17: 47,914,865 (GRCm39) I206T probably benign Het
Ccdc70 A C 8: 22,463,357 (GRCm39) E49A possibly damaging Het
Chd1 A T 17: 15,955,976 (GRCm39) H525L probably damaging Het
Col4a4 T C 1: 82,496,670 (GRCm39) E442G unknown Het
Cpd G A 11: 76,693,133 (GRCm39) P718S probably benign Het
Dip2b T A 15: 100,107,461 (GRCm39) I1391N probably damaging Het
Dpp9 T C 17: 56,501,946 (GRCm39) T541A probably damaging Het
Dst C T 1: 34,218,947 (GRCm39) Q1796* probably null Het
Gm10267 T C 18: 44,291,397 (GRCm39) I25V probably benign Het
Gm32742 C T 9: 51,061,441 (GRCm39) R744Q probably benign Het
Gm37240 T C 3: 84,422,952 (GRCm39) Y139C probably damaging Het
Gm39115 A G 7: 141,689,255 (GRCm39) C173R unknown Het
Grm6 T G 11: 50,750,877 (GRCm39) V680G probably damaging Het
Grxcr2 C T 18: 42,131,956 (GRCm39) D38N probably damaging Het
Iah1 G A 12: 21,366,587 (GRCm39) R52H probably damaging Het
Ift43 A G 12: 86,131,920 (GRCm39) Y36C possibly damaging Het
Igf2r T C 17: 12,945,588 (GRCm39) I334V probably benign Het
Igfn1 T A 1: 135,897,692 (GRCm39) Q958L possibly damaging Het
Il4i1 G A 7: 44,489,263 (GRCm39) A343T possibly damaging Het
Ints1 T C 5: 139,748,217 (GRCm39) I1128V probably benign Het
Irx1 C A 13: 72,111,588 (GRCm39) G7V probably damaging Het
Krr1 A G 10: 111,818,896 (GRCm39) R312G possibly damaging Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,389,857 (GRCm39) probably null Het
Lpin2 A T 17: 71,529,065 (GRCm39) N108Y probably damaging Het
Man2a1 A T 17: 64,943,557 (GRCm39) E204V possibly damaging Het
Megf8 A G 7: 25,030,166 (GRCm39) T434A possibly damaging Het
Minar1 A T 9: 89,484,072 (GRCm39) S442T probably benign Het
Muc16 T C 9: 18,567,285 (GRCm39) T1745A unknown Het
Mycbp2 G T 14: 103,371,474 (GRCm39) P4135T probably damaging Het
Nuggc T C 14: 65,857,045 (GRCm39) V398A possibly damaging Het
Or1e22 A G 11: 73,376,885 (GRCm39) I255T probably damaging Het
Or1e29 A T 11: 73,667,976 (GRCm39) M59K probably damaging Het
Or5w11 C T 2: 87,459,152 (GRCm39) A115V possibly damaging Het
Or6a2 A T 7: 106,600,099 (GRCm39) S323T probably benign Het
Or6e1 G T 14: 54,520,342 (GRCm39) N3K probably damaging Het
Or6f1 A G 7: 85,970,444 (GRCm39) S239P probably damaging Het
Parg A G 14: 31,964,294 (GRCm39) N653S probably damaging Het
Plek A G 11: 16,945,346 (GRCm39) F18L probably benign Het
Pnoc A G 14: 65,639,247 (GRCm39) I206T possibly damaging Het
Ppp4r3a T C 12: 101,049,129 (GRCm39) M1V probably null Het
Pramel21 A G 4: 143,341,699 (GRCm39) T43A probably benign Het
Psg22 T C 7: 18,458,248 (GRCm39) V313A probably benign Het
Ptk2b G T 14: 66,409,546 (GRCm39) P497T probably damaging Het
Rer1 A G 4: 155,160,044 (GRCm39) probably null Het
Rnf130 A G 11: 49,986,618 (GRCm39) T321A probably benign Het
Rnf207 A T 4: 152,397,717 (GRCm39) F346I probably damaging Het
Rraga T A 4: 86,494,574 (GRCm39) I140N possibly damaging Het
Rusc2 A T 4: 43,416,262 (GRCm39) M523L probably benign Het
Sh3bp1 T A 15: 78,792,622 (GRCm39) V495D probably benign Het
Slc44a5 T C 3: 153,945,926 (GRCm39) L153P probably benign Het
Spag16 T C 1: 70,764,072 (GRCm39) S631P probably damaging Het
Syne1 A C 10: 4,984,937 (GRCm39) L747R probably damaging Het
Tac1 A G 6: 7,555,675 (GRCm39) E21G probably benign Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tln1 T C 4: 43,542,957 (GRCm39) D1344G probably damaging Het
Tnc C T 4: 63,926,045 (GRCm39) E912K probably damaging Het
Trav16d-dv11 A G 14: 53,285,037 (GRCm39) T38A probably benign Het
Trbv15 T A 6: 41,118,364 (GRCm39) L40Q probably damaging Het
Trpa1 T C 1: 14,973,455 (GRCm39) I288V possibly damaging Het
Ttn A T 2: 76,604,941 (GRCm39) I18331N probably damaging Het
Tubgcp2 A T 7: 139,587,836 (GRCm39) I263N probably damaging Het
Ugt8a T C 3: 125,708,957 (GRCm39) H51R probably benign Het
Vmn2r2 T C 3: 64,023,870 (GRCm39) T904A probably benign Het
Zfp575 G A 7: 24,285,323 (GRCm39) T106M probably damaging Het
Zfp617 A G 8: 72,686,539 (GRCm39) T290A probably benign Het
Zfp809 T C 9: 22,149,863 (GRCm39) V120A probably benign Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R1976:Abcb5 UTSW 12 118,854,417 (GRCm39) missense probably benign
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5327:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118,875,234 (GRCm39) missense probably benign
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118,908,641 (GRCm39) missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8177:Abcb5 UTSW 12 118,836,525 (GRCm39) missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCACCAGTTTTGTTGTGG -3'
(R):5'- ACCATGGGTGCAACTTTCC -3'

Sequencing Primer
(F):5'- GCTGCTGTTCCTTAGGTAGG -3'
(R):5'- CTATGTCCACTGTAAACACTGC -3'
Posted On 2022-11-14