Incidental Mutation 'R9666:Dip2b'
ID 735746
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock # R9666 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100209580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1391 (I1391N)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: I1157N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: I1157N

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: I1391N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: I1391N

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C A 12: 118,874,687 V1047L probably damaging Het
AF529169 A T 9: 89,602,019 S442T probably benign Het
Akap6 G A 12: 53,141,535 A1911T probably benign Het
Ank2 T A 3: 126,933,189 K819* probably null Het
Apc2 A G 10: 80,311,349 R746G possibly damaging Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Bysl A G 17: 47,603,940 I206T probably benign Het
Ccdc70 A C 8: 21,973,341 E49A possibly damaging Het
Chd1 A T 17: 15,735,714 H525L probably damaging Het
Col4a4 T C 1: 82,518,949 E442G unknown Het
Cpd G A 11: 76,802,307 P718S probably benign Het
Dpp9 T C 17: 56,194,946 T541A probably damaging Het
Dst C T 1: 34,179,866 Q1796* probably null Het
Gm10267 T C 18: 44,158,330 I25V probably benign Het
Gm13083 A G 4: 143,615,129 T43A probably benign Het
Gm32742 C T 9: 51,150,141 R744Q probably benign Het
Gm37240 T C 3: 84,515,645 Y139C probably damaging Het
Gm39115 A G 7: 142,135,518 C173R unknown Het
Grm6 T G 11: 50,860,050 V680G probably damaging Het
Grxcr2 C T 18: 41,998,891 D38N probably damaging Het
Iah1 G A 12: 21,316,586 R52H probably damaging Het
Ift43 A G 12: 86,085,146 Y36C possibly damaging Het
Igf2r T C 17: 12,726,701 I334V probably benign Het
Igfn1 T A 1: 135,969,954 Q958L possibly damaging Het
Il4i1 G A 7: 44,839,839 A343T possibly damaging Het
Ints1 T C 5: 139,762,462 I1128V probably benign Het
Irx1 C A 13: 71,963,469 G7V probably damaging Het
Krr1 A G 10: 111,982,991 R312G possibly damaging Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,482,550 probably null Het
Lpin2 A T 17: 71,222,070 N108Y probably damaging Het
Man2a1 A T 17: 64,636,562 E204V possibly damaging Het
Megf8 A G 7: 25,330,741 T434A possibly damaging Het
Muc16 T C 9: 18,655,989 T1745A unknown Het
Mycbp2 G T 14: 103,134,038 P4135T probably damaging Het
Nuggc T C 14: 65,619,596 V398A possibly damaging Het
Olfr1131 C T 2: 87,628,808 A115V possibly damaging Het
Olfr2 A T 7: 107,000,892 S323T probably benign Het
Olfr308 A G 7: 86,321,236 S239P probably damaging Het
Olfr381 A G 11: 73,486,059 I255T probably damaging Het
Olfr389 A T 11: 73,777,150 M59K probably damaging Het
Olfr49 G T 14: 54,282,885 N3K probably damaging Het
Parg A G 14: 32,242,337 N653S probably damaging Het
Plek A G 11: 16,995,346 F18L probably benign Het
Pnoc A G 14: 65,401,798 I206T possibly damaging Het
Ppp4r3a T C 12: 101,082,870 M1V probably null Het
Psg22 T C 7: 18,724,323 V313A probably benign Het
Ptk2b G T 14: 66,172,097 P497T probably damaging Het
Rer1 A G 4: 155,075,587 probably null Het
Rnf130 A G 11: 50,095,791 T321A probably benign Het
Rnf207 A T 4: 152,313,260 F346I probably damaging Het
Rraga T A 4: 86,576,337 I140N possibly damaging Het
Rusc2 A T 4: 43,416,262 M523L probably benign Het
Sh3bp1 T A 15: 78,908,422 V495D probably benign Het
Slc44a5 T C 3: 154,240,289 L153P probably benign Het
Spag16 T C 1: 70,724,913 S631P probably damaging Het
Syne1 A C 10: 5,034,937 L747R probably damaging Het
Tac1 A G 6: 7,555,675 E21G probably benign Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tln1 T C 4: 43,542,957 D1344G probably damaging Het
Tnc C T 4: 64,007,808 E912K probably damaging Het
Trav16d-dv11 A G 14: 53,047,580 T38A probably benign Het
Trbv15 T A 6: 41,141,430 L40Q probably damaging Het
Trpa1 T C 1: 14,903,231 I288V possibly damaging Het
Ttn A T 2: 76,774,597 I18331N probably damaging Het
Tubgcp2 A T 7: 140,007,923 I263N probably damaging Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vmn2r2 T C 3: 64,116,449 T904A probably benign Het
Zfp575 G A 7: 24,585,898 T106M probably damaging Het
Zfp617 A G 8: 71,932,695 T290A probably benign Het
Zfp809 T C 9: 22,238,567 V120A probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7463:Dip2b UTSW 15 100154157 missense probably benign
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
R9289:Dip2b UTSW 15 100173271 missense probably damaging 0.97
R9405:Dip2b UTSW 15 100195876 missense probably benign 0.05
R9477:Dip2b UTSW 15 100038903 missense probably damaging 1.00
R9485:Dip2b UTSW 15 100155043 missense probably benign 0.05
R9533:Dip2b UTSW 15 100175297 missense probably benign 0.06
R9581:Dip2b UTSW 15 100181374 missense probably damaging 0.99
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCAAGCCAGTTAAGTCCC -3'
(R):5'- AAGATACCTCCAGTGGCTGC -3'

Sequencing Primer
(F):5'- GCCAGTTAAGTCCCTCATAGAG -3'
(R):5'- TGCAGTGAGCTCAGTCCTG -3'
Posted On 2022-11-14