Incidental Mutation 'R9666:Dip2b'
ID 735746
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R9666 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100107461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1391 (I1391N)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: I1157N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: I1157N

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: I1391N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: I1391N

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C A 12: 118,838,422 (GRCm39) V1047L probably damaging Het
Akap6 G A 12: 53,188,318 (GRCm39) A1911T probably benign Het
Ank2 T A 3: 126,726,838 (GRCm39) K819* probably null Het
Apc2 A G 10: 80,147,183 (GRCm39) R746G possibly damaging Het
Baz1a A G 12: 54,988,345 (GRCm39) I268T probably benign Het
Bysl A G 17: 47,914,865 (GRCm39) I206T probably benign Het
Ccdc70 A C 8: 22,463,357 (GRCm39) E49A possibly damaging Het
Chd1 A T 17: 15,955,976 (GRCm39) H525L probably damaging Het
Col4a4 T C 1: 82,496,670 (GRCm39) E442G unknown Het
Cpd G A 11: 76,693,133 (GRCm39) P718S probably benign Het
Dpp9 T C 17: 56,501,946 (GRCm39) T541A probably damaging Het
Dst C T 1: 34,218,947 (GRCm39) Q1796* probably null Het
Gm10267 T C 18: 44,291,397 (GRCm39) I25V probably benign Het
Gm32742 C T 9: 51,061,441 (GRCm39) R744Q probably benign Het
Gm37240 T C 3: 84,422,952 (GRCm39) Y139C probably damaging Het
Gm39115 A G 7: 141,689,255 (GRCm39) C173R unknown Het
Grm6 T G 11: 50,750,877 (GRCm39) V680G probably damaging Het
Grxcr2 C T 18: 42,131,956 (GRCm39) D38N probably damaging Het
Iah1 G A 12: 21,366,587 (GRCm39) R52H probably damaging Het
Ift43 A G 12: 86,131,920 (GRCm39) Y36C possibly damaging Het
Igf2r T C 17: 12,945,588 (GRCm39) I334V probably benign Het
Igfn1 T A 1: 135,897,692 (GRCm39) Q958L possibly damaging Het
Il4i1 G A 7: 44,489,263 (GRCm39) A343T possibly damaging Het
Ints1 T C 5: 139,748,217 (GRCm39) I1128V probably benign Het
Irx1 C A 13: 72,111,588 (GRCm39) G7V probably damaging Het
Krr1 A G 10: 111,818,896 (GRCm39) R312G possibly damaging Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,389,857 (GRCm39) probably null Het
Lpin2 A T 17: 71,529,065 (GRCm39) N108Y probably damaging Het
Man2a1 A T 17: 64,943,557 (GRCm39) E204V possibly damaging Het
Megf8 A G 7: 25,030,166 (GRCm39) T434A possibly damaging Het
Minar1 A T 9: 89,484,072 (GRCm39) S442T probably benign Het
Muc16 T C 9: 18,567,285 (GRCm39) T1745A unknown Het
Mycbp2 G T 14: 103,371,474 (GRCm39) P4135T probably damaging Het
Nuggc T C 14: 65,857,045 (GRCm39) V398A possibly damaging Het
Or1e22 A G 11: 73,376,885 (GRCm39) I255T probably damaging Het
Or1e29 A T 11: 73,667,976 (GRCm39) M59K probably damaging Het
Or5w11 C T 2: 87,459,152 (GRCm39) A115V possibly damaging Het
Or6a2 A T 7: 106,600,099 (GRCm39) S323T probably benign Het
Or6e1 G T 14: 54,520,342 (GRCm39) N3K probably damaging Het
Or6f1 A G 7: 85,970,444 (GRCm39) S239P probably damaging Het
Parg A G 14: 31,964,294 (GRCm39) N653S probably damaging Het
Plek A G 11: 16,945,346 (GRCm39) F18L probably benign Het
Pnoc A G 14: 65,639,247 (GRCm39) I206T possibly damaging Het
Ppp4r3a T C 12: 101,049,129 (GRCm39) M1V probably null Het
Pramel21 A G 4: 143,341,699 (GRCm39) T43A probably benign Het
Psg22 T C 7: 18,458,248 (GRCm39) V313A probably benign Het
Ptk2b G T 14: 66,409,546 (GRCm39) P497T probably damaging Het
Rer1 A G 4: 155,160,044 (GRCm39) probably null Het
Rnf130 A G 11: 49,986,618 (GRCm39) T321A probably benign Het
Rnf207 A T 4: 152,397,717 (GRCm39) F346I probably damaging Het
Rraga T A 4: 86,494,574 (GRCm39) I140N possibly damaging Het
Rusc2 A T 4: 43,416,262 (GRCm39) M523L probably benign Het
Sh3bp1 T A 15: 78,792,622 (GRCm39) V495D probably benign Het
Slc44a5 T C 3: 153,945,926 (GRCm39) L153P probably benign Het
Spag16 T C 1: 70,764,072 (GRCm39) S631P probably damaging Het
Syne1 A C 10: 4,984,937 (GRCm39) L747R probably damaging Het
Tac1 A G 6: 7,555,675 (GRCm39) E21G probably benign Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tln1 T C 4: 43,542,957 (GRCm39) D1344G probably damaging Het
Tnc C T 4: 63,926,045 (GRCm39) E912K probably damaging Het
Trav16d-dv11 A G 14: 53,285,037 (GRCm39) T38A probably benign Het
Trbv15 T A 6: 41,118,364 (GRCm39) L40Q probably damaging Het
Trpa1 T C 1: 14,973,455 (GRCm39) I288V possibly damaging Het
Ttn A T 2: 76,604,941 (GRCm39) I18331N probably damaging Het
Tubgcp2 A T 7: 139,587,836 (GRCm39) I263N probably damaging Het
Ugt8a T C 3: 125,708,957 (GRCm39) H51R probably benign Het
Vmn2r2 T C 3: 64,023,870 (GRCm39) T904A probably benign Het
Zfp575 G A 7: 24,285,323 (GRCm39) T106M probably damaging Het
Zfp617 A G 8: 72,686,539 (GRCm39) T290A probably benign Het
Zfp809 T C 9: 22,149,863 (GRCm39) V120A probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCAAGCCAGTTAAGTCCC -3'
(R):5'- AAGATACCTCCAGTGGCTGC -3'

Sequencing Primer
(F):5'- GCCAGTTAAGTCCCTCATAGAG -3'
(R):5'- TGCAGTGAGCTCAGTCCTG -3'
Posted On 2022-11-14