Incidental Mutation 'R9666:Chd1'
ID 735748
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9666 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 15704967-15772610 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15735714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 525 (H525L)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
AlphaFold P40201
Predicted Effect probably damaging
Transcript: ENSMUST00000024627
AA Change: H525L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: H525L

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173311
AA Change: H525L

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: H525L

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174461
SMART Domains Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852

DomainStartEndE-ValueType
Pfam:SNF2_N 1 148 3.6e-34 PFAM
low complexity region 172 184 N/A INTRINSIC
HELICc 201 285 8.48e-25 SMART
Blast:DEXDc 340 516 1e-47 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C A 12: 118,874,687 V1047L probably damaging Het
AF529169 A T 9: 89,602,019 S442T probably benign Het
Akap6 G A 12: 53,141,535 A1911T probably benign Het
Ank2 T A 3: 126,933,189 K819* probably null Het
Apc2 A G 10: 80,311,349 R746G possibly damaging Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Bysl A G 17: 47,603,940 I206T probably benign Het
Ccdc70 A C 8: 21,973,341 E49A possibly damaging Het
Col4a4 T C 1: 82,518,949 E442G unknown Het
Cpd G A 11: 76,802,307 P718S probably benign Het
Dip2b T A 15: 100,209,580 I1391N probably damaging Het
Dpp9 T C 17: 56,194,946 T541A probably damaging Het
Dst C T 1: 34,179,866 Q1796* probably null Het
Gm10267 T C 18: 44,158,330 I25V probably benign Het
Gm13083 A G 4: 143,615,129 T43A probably benign Het
Gm32742 C T 9: 51,150,141 R744Q probably benign Het
Gm37240 T C 3: 84,515,645 Y139C probably damaging Het
Gm39115 A G 7: 142,135,518 C173R unknown Het
Grm6 T G 11: 50,860,050 V680G probably damaging Het
Grxcr2 C T 18: 41,998,891 D38N probably damaging Het
Iah1 G A 12: 21,316,586 R52H probably damaging Het
Ift43 A G 12: 86,085,146 Y36C possibly damaging Het
Igf2r T C 17: 12,726,701 I334V probably benign Het
Igfn1 T A 1: 135,969,954 Q958L possibly damaging Het
Il4i1 G A 7: 44,839,839 A343T possibly damaging Het
Ints1 T C 5: 139,762,462 I1128V probably benign Het
Irx1 C A 13: 71,963,469 G7V probably damaging Het
Krr1 A G 10: 111,982,991 R312G possibly damaging Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,482,550 probably null Het
Lpin2 A T 17: 71,222,070 N108Y probably damaging Het
Man2a1 A T 17: 64,636,562 E204V possibly damaging Het
Megf8 A G 7: 25,330,741 T434A possibly damaging Het
Muc16 T C 9: 18,655,989 T1745A unknown Het
Mycbp2 G T 14: 103,134,038 P4135T probably damaging Het
Nuggc T C 14: 65,619,596 V398A possibly damaging Het
Olfr1131 C T 2: 87,628,808 A115V possibly damaging Het
Olfr2 A T 7: 107,000,892 S323T probably benign Het
Olfr308 A G 7: 86,321,236 S239P probably damaging Het
Olfr381 A G 11: 73,486,059 I255T probably damaging Het
Olfr389 A T 11: 73,777,150 M59K probably damaging Het
Olfr49 G T 14: 54,282,885 N3K probably damaging Het
Parg A G 14: 32,242,337 N653S probably damaging Het
Plek A G 11: 16,995,346 F18L probably benign Het
Pnoc A G 14: 65,401,798 I206T possibly damaging Het
Ppp4r3a T C 12: 101,082,870 M1V probably null Het
Psg22 T C 7: 18,724,323 V313A probably benign Het
Ptk2b G T 14: 66,172,097 P497T probably damaging Het
Rer1 A G 4: 155,075,587 probably null Het
Rnf130 A G 11: 50,095,791 T321A probably benign Het
Rnf207 A T 4: 152,313,260 F346I probably damaging Het
Rraga T A 4: 86,576,337 I140N possibly damaging Het
Rusc2 A T 4: 43,416,262 M523L probably benign Het
Sh3bp1 T A 15: 78,908,422 V495D probably benign Het
Slc44a5 T C 3: 154,240,289 L153P probably benign Het
Spag16 T C 1: 70,724,913 S631P probably damaging Het
Syne1 A C 10: 5,034,937 L747R probably damaging Het
Tac1 A G 6: 7,555,675 E21G probably benign Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tln1 T C 4: 43,542,957 D1344G probably damaging Het
Tnc C T 4: 64,007,808 E912K probably damaging Het
Trav16d-dv11 A G 14: 53,047,580 T38A probably benign Het
Trbv15 T A 6: 41,141,430 L40Q probably damaging Het
Trpa1 T C 1: 14,903,231 I288V possibly damaging Het
Ttn A T 2: 76,774,597 I18331N probably damaging Het
Tubgcp2 A T 7: 140,007,923 I263N probably damaging Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vmn2r2 T C 3: 64,116,449 T904A probably benign Het
Zfp575 G A 7: 24,585,898 T106M probably damaging Het
Zfp617 A G 8: 71,932,695 T290A probably benign Het
Zfp809 T C 9: 22,238,567 V120A probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
R9067:Chd1 UTSW 17 15730845 missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15742289 missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15730505 missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15730505 missense possibly damaging 0.70
R9673:Chd1 UTSW 17 15768761 missense probably benign 0.24
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCGCTTAATGCTAGAGG -3'
(R):5'- GATAGATCTGTCTAGCCTACTAAGTTC -3'

Sequencing Primer
(F):5'- CCGCTTAATGCTAGAGGATAAACTGC -3'
(R):5'- GTCTAGCCTACTAAGTTCATGGAAAG -3'
Posted On 2022-11-14