Incidental Mutation 'R9678:Trpm7'
ID 735758
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Name transient receptor potential cation channel, subfamily M, member 7
Synonyms CHAK, 5033407O22Rik, TRP-PLIK, 4833414K03Rik, CHAK1, LTRPC7, Ltpr7, 2310022G15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 126633485-126718150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126686290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 313 (V313F)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
AlphaFold Q923J1
PDB Structure CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028843
AA Change: V313F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: V313F

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103224
AA Change: V313F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: V313F

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126,670,951 (GRCm39) missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126,687,992 (GRCm39) critical splice donor site probably null
IGL01634:Trpm7 APN 2 126,668,738 (GRCm39) missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126,658,719 (GRCm39) missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126,655,104 (GRCm39) missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126,639,863 (GRCm39) missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126,641,163 (GRCm39) unclassified probably benign
IGL02172:Trpm7 APN 2 126,637,248 (GRCm39) missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126,649,282 (GRCm39) missense probably benign
IGL02375:Trpm7 APN 2 126,667,664 (GRCm39) missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126,661,811 (GRCm39) missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126,682,699 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126,688,079 (GRCm39) missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126,649,207 (GRCm39) critical splice donor site probably null
Accused UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
Condemned UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
denounced UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
deposed UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
Summac UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
Vacated UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126,658,677 (GRCm39) splice site probably benign
R0038:Trpm7 UTSW 2 126,637,388 (GRCm39) missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126,654,691 (GRCm39) missense probably benign
R0165:Trpm7 UTSW 2 126,639,433 (GRCm39) missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126,668,638 (GRCm39) nonsense probably null
R0543:Trpm7 UTSW 2 126,690,449 (GRCm39) missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126,687,992 (GRCm39) critical splice donor site probably null
R0844:Trpm7 UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126,641,159 (GRCm39) splice site probably null
R0919:Trpm7 UTSW 2 126,673,158 (GRCm39) missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126,646,969 (GRCm39) missense probably benign
R1109:Trpm7 UTSW 2 126,639,713 (GRCm39) missense probably benign 0.01
R1118:Trpm7 UTSW 2 126,664,406 (GRCm39) missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126,667,374 (GRCm39) nonsense probably null
R1527:Trpm7 UTSW 2 126,672,082 (GRCm39) missense probably benign 0.18
R1542:Trpm7 UTSW 2 126,664,519 (GRCm39) nonsense probably null
R1882:Trpm7 UTSW 2 126,654,697 (GRCm39) missense probably benign 0.00
R1951:Trpm7 UTSW 2 126,673,219 (GRCm39) missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2012:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2026:Trpm7 UTSW 2 126,654,658 (GRCm39) missense probably benign 0.39
R2067:Trpm7 UTSW 2 126,639,647 (GRCm39) missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126,700,329 (GRCm39) splice site probably benign
R3082:Trpm7 UTSW 2 126,686,342 (GRCm39) missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126,668,630 (GRCm39) splice site probably benign
R3607:Trpm7 UTSW 2 126,638,348 (GRCm39) intron probably benign
R3739:Trpm7 UTSW 2 126,693,441 (GRCm39) missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126,673,138 (GRCm39) missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126,658,751 (GRCm39) missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126,671,083 (GRCm39) missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126,690,458 (GRCm39) missense probably damaging 1.00
R4392:Trpm7 UTSW 2 126,637,429 (GRCm39) splice site probably null
R4404:Trpm7 UTSW 2 126,675,635 (GRCm39) missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126,639,131 (GRCm39) missense probably benign 0.01
R4714:Trpm7 UTSW 2 126,682,703 (GRCm39) nonsense probably null
R4807:Trpm7 UTSW 2 126,673,149 (GRCm39) missense probably benign 0.00
R4815:Trpm7 UTSW 2 126,700,412 (GRCm39) missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126,655,105 (GRCm39) missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126,665,978 (GRCm39) missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126,638,256 (GRCm39) critical splice donor site probably null
R5263:Trpm7 UTSW 2 126,663,137 (GRCm39) missense probably benign 0.34
R5361:Trpm7 UTSW 2 126,671,161 (GRCm39) missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126,684,775 (GRCm39) critical splice donor site probably null
R5574:Trpm7 UTSW 2 126,654,950 (GRCm39) missense probably benign
R5782:Trpm7 UTSW 2 126,639,634 (GRCm39) missense probably benign 0.04
R5840:Trpm7 UTSW 2 126,664,531 (GRCm39) nonsense probably null
R6044:Trpm7 UTSW 2 126,656,665 (GRCm39) missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126,679,301 (GRCm39) missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126,667,559 (GRCm39) missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126,649,214 (GRCm39) missense probably benign
R6530:Trpm7 UTSW 2 126,654,631 (GRCm39) missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126,686,340 (GRCm39) missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
R6868:Trpm7 UTSW 2 126,679,334 (GRCm39) missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126,668,685 (GRCm39) missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126,641,126 (GRCm39) missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126,673,115 (GRCm39) critical splice donor site probably null
R7509:Trpm7 UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
R7586:Trpm7 UTSW 2 126,652,085 (GRCm39) missense probably benign
R7774:Trpm7 UTSW 2 126,655,158 (GRCm39) missense probably benign 0.09
R7793:Trpm7 UTSW 2 126,665,995 (GRCm39) nonsense probably null
R7812:Trpm7 UTSW 2 126,641,236 (GRCm39) missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
R7951:Trpm7 UTSW 2 126,655,188 (GRCm39) missense possibly damaging 0.94
R7965:Trpm7 UTSW 2 126,667,614 (GRCm39) missense probably damaging 0.99
R7992:Trpm7 UTSW 2 126,667,454 (GRCm39) missense probably benign
R8034:Trpm7 UTSW 2 126,688,119 (GRCm39) missense probably damaging 0.98
R8199:Trpm7 UTSW 2 126,691,918 (GRCm39) missense probably damaging 1.00
R8304:Trpm7 UTSW 2 126,639,797 (GRCm39) missense probably damaging 1.00
R8405:Trpm7 UTSW 2 126,658,755 (GRCm39) missense probably benign 0.26
R8674:Trpm7 UTSW 2 126,641,086 (GRCm39) unclassified probably benign
R8742:Trpm7 UTSW 2 126,667,469 (GRCm39) missense probably damaging 1.00
R8754:Trpm7 UTSW 2 126,664,623 (GRCm39) missense probably damaging 1.00
R8842:Trpm7 UTSW 2 126,663,131 (GRCm39) missense probably benign 0.05
R8850:Trpm7 UTSW 2 126,652,100 (GRCm39) missense probably benign 0.00
R8881:Trpm7 UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
R8898:Trpm7 UTSW 2 126,664,661 (GRCm39) missense possibly damaging 0.92
R9339:Trpm7 UTSW 2 126,665,906 (GRCm39) missense probably benign 0.04
R9428:Trpm7 UTSW 2 126,671,140 (GRCm39) missense probably damaging 1.00
R9446:Trpm7 UTSW 2 126,672,185 (GRCm39) critical splice acceptor site probably null
R9568:Trpm7 UTSW 2 126,664,510 (GRCm39) missense probably benign 0.02
R9647:Trpm7 UTSW 2 126,667,562 (GRCm39) missense probably damaging 1.00
R9746:Trpm7 UTSW 2 126,664,578 (GRCm39) missense possibly damaging 0.47
X0026:Trpm7 UTSW 2 126,671,210 (GRCm39) missense probably benign
Z1088:Trpm7 UTSW 2 126,639,201 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTGCCTTAAGTCTGAACAAAG -3'
(R):5'- GGTAAAGCCAACTGTTTCACATG -3'

Sequencing Primer
(F):5'- ACAAAGGAATTCAGTACTGG -3'
(R):5'- GAATTGGGCAAGGAGTTC -3'
Posted On 2022-11-14