Incidental Mutation 'R9678:Zbbx'
ID 735760
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Name zinc finger, B-box domain containing
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 74945214-75072341 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75046841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 26 (L26P)
Ref Sequence ENSEMBL: ENSMUSP00000103407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778] [ENSMUST00000124618]
AlphaFold Q0P5X5
Predicted Effect probably damaging
Transcript: ENSMUST00000039269
AA Change: L26P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: L26P

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107775
AA Change: L26P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: L26P

DomainStartEndE-ValueType
Pfam:zf-B_box 12 58 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107776
AA Change: L26P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: L26P

DomainStartEndE-ValueType
Blast:BBOX 13 58 1e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107778
AA Change: L26P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: L26P

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000124618
AA Change: L142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122459
Gene: ENSMUSG00000034151
AA Change: L142P

DomainStartEndE-ValueType
coiled coil region 23 60 N/A INTRINSIC
Pfam:zf-B_box 128 174 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 74,968,839 (GRCm39) critical splice donor site probably null
IGL01328:Zbbx APN 3 75,000,382 (GRCm39) nonsense probably null
IGL01340:Zbbx APN 3 75,012,957 (GRCm39) missense possibly damaging 0.53
IGL01631:Zbbx APN 3 74,985,984 (GRCm39) missense probably damaging 0.99
IGL01681:Zbbx APN 3 74,959,785 (GRCm39) missense probably damaging 1.00
IGL02427:Zbbx APN 3 75,046,905 (GRCm39) missense probably benign 0.04
IGL03077:Zbbx APN 3 74,989,153 (GRCm39) missense possibly damaging 0.61
IGL03115:Zbbx APN 3 74,985,867 (GRCm39) missense probably benign 0.03
IGL03162:Zbbx APN 3 74,978,930 (GRCm39) splice site probably benign
Eland UTSW 3 74,979,019 (GRCm39) missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75,043,794 (GRCm39) missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 74,968,944 (GRCm39) missense probably damaging 1.00
R0179:Zbbx UTSW 3 74,992,869 (GRCm39) splice site probably benign
R0396:Zbbx UTSW 3 74,985,802 (GRCm39) missense possibly damaging 0.81
R0523:Zbbx UTSW 3 74,989,165 (GRCm39) missense probably benign 0.03
R0603:Zbbx UTSW 3 74,985,757 (GRCm39) missense probably benign 0.05
R0745:Zbbx UTSW 3 75,062,734 (GRCm39) missense probably damaging 1.00
R0747:Zbbx UTSW 3 75,062,734 (GRCm39) missense probably damaging 1.00
R1208:Zbbx UTSW 3 74,945,299 (GRCm39) missense possibly damaging 0.94
R1208:Zbbx UTSW 3 74,945,299 (GRCm39) missense possibly damaging 0.94
R1371:Zbbx UTSW 3 74,959,784 (GRCm39) missense possibly damaging 0.58
R1769:Zbbx UTSW 3 74,990,926 (GRCm39) splice site probably benign
R1906:Zbbx UTSW 3 74,979,047 (GRCm39) missense probably damaging 1.00
R2069:Zbbx UTSW 3 74,985,719 (GRCm39) missense probably benign 0.01
R2165:Zbbx UTSW 3 75,019,414 (GRCm39) missense probably damaging 0.99
R2174:Zbbx UTSW 3 74,959,721 (GRCm39) missense possibly damaging 0.93
R2979:Zbbx UTSW 3 74,985,793 (GRCm39) nonsense probably null
R3121:Zbbx UTSW 3 74,989,153 (GRCm39) missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R3756:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R3816:Zbbx UTSW 3 74,992,802 (GRCm39) missense probably benign 0.00
R4002:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R4003:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R4057:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R4072:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R4073:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R4075:Zbbx UTSW 3 75,012,978 (GRCm39) missense probably damaging 1.00
R4114:Zbbx UTSW 3 75,046,905 (GRCm39) missense probably benign 0.04
R4784:Zbbx UTSW 3 74,992,348 (GRCm39) missense probably benign 0.05
R4821:Zbbx UTSW 3 74,989,054 (GRCm39) missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75,058,755 (GRCm39) missense possibly damaging 0.62
R5030:Zbbx UTSW 3 74,990,990 (GRCm39) missense possibly damaging 0.83
R5388:Zbbx UTSW 3 74,990,977 (GRCm39) missense probably damaging 0.98
R6398:Zbbx UTSW 3 74,985,872 (GRCm39) missense probably damaging 0.96
R6462:Zbbx UTSW 3 74,985,966 (GRCm39) missense probably benign 0.07
R6597:Zbbx UTSW 3 75,043,761 (GRCm39) missense probably damaging 1.00
R6882:Zbbx UTSW 3 74,979,019 (GRCm39) missense probably benign 0.01
R7084:Zbbx UTSW 3 75,046,853 (GRCm39) missense possibly damaging 0.92
R7096:Zbbx UTSW 3 74,989,044 (GRCm39) missense probably benign 0.03
R7102:Zbbx UTSW 3 75,019,401 (GRCm39) missense probably benign 0.06
R7256:Zbbx UTSW 3 74,947,205 (GRCm39) missense probably benign 0.02
R7537:Zbbx UTSW 3 74,992,826 (GRCm39) missense probably damaging 1.00
R7836:Zbbx UTSW 3 74,985,781 (GRCm39) missense possibly damaging 0.65
R7905:Zbbx UTSW 3 74,992,820 (GRCm39) missense probably benign 0.23
R8110:Zbbx UTSW 3 75,062,749 (GRCm39) missense possibly damaging 0.58
R8367:Zbbx UTSW 3 74,989,034 (GRCm39) critical splice donor site probably null
R8772:Zbbx UTSW 3 75,062,692 (GRCm39) missense probably benign 0.37
R8859:Zbbx UTSW 3 74,968,741 (GRCm39) missense unknown
R9012:Zbbx UTSW 3 74,968,960 (GRCm39) missense possibly damaging 0.73
R9062:Zbbx UTSW 3 74,989,124 (GRCm39) missense possibly damaging 0.78
R9119:Zbbx UTSW 3 74,985,897 (GRCm39) missense probably damaging 0.99
R9401:Zbbx UTSW 3 75,019,390 (GRCm39) missense probably benign 0.26
R9531:Zbbx UTSW 3 74,985,865 (GRCm39) missense probably damaging 1.00
R9736:Zbbx UTSW 3 74,968,741 (GRCm39) missense unknown
R9780:Zbbx UTSW 3 74,945,359 (GRCm39) missense probably damaging 1.00
Z1177:Zbbx UTSW 3 75,012,991 (GRCm39) missense probably damaging 0.98
Z1177:Zbbx UTSW 3 74,979,090 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCAGATATGATTTTAAATGGTGC -3'
(R):5'- TGTGAGAATTTGGAGACGCTC -3'

Sequencing Primer
(F):5'- TTAAATGGTGCTATTAAGAGAGAGTG -3'
(R):5'- GGAGACGCTCATAGTTTCGTTACC -3'
Posted On 2022-11-14