Incidental Mutation 'R9678:Meaf6'
ID 735761
Institutional Source Beutler Lab
Gene Symbol Meaf6
Ensembl Gene ENSMUSG00000028863
Gene Name MYST/Esa1-associated factor 6
Synonyms 2810036M01Rik, 2310005N01Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.787) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 124978927-125007031 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124996689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 133 (N133S)
Ref Sequence ENSEMBL: ENSMUSP00000053543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055213] [ENSMUST00000106171] [ENSMUST00000154689] [ENSMUST00000184205]
AlphaFold Q2VPQ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000055213
AA Change: N133S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053543
Gene: ENSMUSG00000028863
AA Change: N133S

DomainStartEndE-ValueType
Pfam:NuA4 17 96 1.1e-29 PFAM
low complexity region 157 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106171
AA Change: N105S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101777
Gene: ENSMUSG00000028863
AA Change: N105S

DomainStartEndE-ValueType
Pfam:NuA4 1 45 9e-14 PFAM
low complexity region 105 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154689
AA Change: N133S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122288
Gene: ENSMUSG00000028863
AA Change: N133S

DomainStartEndE-ValueType
Pfam:NuA4 16 97 3e-33 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000184205
AA Change: N133S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138973
Gene: ENSMUSG00000028863
AA Change: N133S

DomainStartEndE-ValueType
Pfam:NuA4 16 97 2.6e-33 PFAM
low complexity region 157 178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in transcriptional activation. The encoded protein may form a component of several different histone acetyltransferase complexes. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Meaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1573:Meaf6 UTSW 4 124,983,931 (GRCm39) missense probably benign 0.29
R4827:Meaf6 UTSW 4 124,996,713 (GRCm39) missense probably damaging 0.98
R6513:Meaf6 UTSW 4 124,983,697 (GRCm39) missense probably damaging 1.00
R7888:Meaf6 UTSW 4 125,003,213 (GRCm39) splice site probably null
R8032:Meaf6 UTSW 4 124,996,795 (GRCm39) missense unknown
R8852:Meaf6 UTSW 4 124,979,990 (GRCm39) missense probably damaging 1.00
R8860:Meaf6 UTSW 4 124,979,990 (GRCm39) missense probably damaging 1.00
R9007:Meaf6 UTSW 4 125,001,450 (GRCm39) intron probably benign
R9306:Meaf6 UTSW 4 124,996,766 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGCCCTTAGTGCTCTGAG -3'
(R):5'- AGCATGTGTGAGGACTCTGG -3'

Sequencing Primer
(F):5'- TGCAGACCACGTGGATTTCAG -3'
(R):5'- GGTGGGACCCTGCCACTAAC -3'
Posted On 2022-11-14