Incidental Mutation 'R9678:Ugdh'
ID 735762
Institutional Source Beutler Lab
Gene Symbol Ugdh
Ensembl Gene ENSMUSG00000029201
Gene Name UDP-glucose dehydrogenase
Synonyms Udpgdh
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 65570550-65593185 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65581470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000031103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031103] [ENSMUST00000131263] [ENSMUST00000196121]
AlphaFold O70475
Predicted Effect possibly damaging
Transcript: ENSMUST00000031103
AA Change: V60A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031103
Gene: ENSMUSG00000029201
AA Change: V60A

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 195 1.5e-63 PFAM
Pfam:UDPG_MGDP_dh 214 309 1.8e-34 PFAM
UDPG_MGDP_dh_C 332 447 1.89e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131263
AA Change: V60A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118999
Gene: ENSMUSG00000029201
AA Change: V60A

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 157 4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196121
SMART Domains Protein: ENSMUSP00000143665
Gene: ENSMUSG00000105835

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 50 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene converts UDP-glucose to UDP-glucuronate and thereby participates in the biosynthesis of glycosaminoglycans such as hyaluronan, chondroitin sulfate, and heparan sulfate. These glycosylated compounds are common components of the extracellular matrix and likely play roles in signal transduction, cell migration, and cancer growth and metastasis. The expression of this gene is up-regulated by transforming growth factor beta and down-regulated by hypoxia. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutation of this gene results in developmental arrest during gastrulation with defects in endoderm and mesoderm migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Ugdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Ugdh APN 5 65,574,248 (GRCm39) missense probably benign 0.12
IGL01734:Ugdh APN 5 65,580,031 (GRCm39) missense probably benign
IGL02157:Ugdh APN 5 65,580,035 (GRCm39) missense probably damaging 0.99
R1677:Ugdh UTSW 5 65,580,521 (GRCm39) missense probably damaging 1.00
R1836:Ugdh UTSW 5 65,577,634 (GRCm39) nonsense probably null
R1882:Ugdh UTSW 5 65,580,939 (GRCm39) missense possibly damaging 0.86
R2020:Ugdh UTSW 5 65,574,268 (GRCm39) missense probably damaging 1.00
R2166:Ugdh UTSW 5 65,574,357 (GRCm39) splice site probably benign
R2256:Ugdh UTSW 5 65,574,458 (GRCm39) splice site probably benign
R2257:Ugdh UTSW 5 65,574,458 (GRCm39) splice site probably benign
R2332:Ugdh UTSW 5 65,584,827 (GRCm39) missense possibly damaging 0.63
R4707:Ugdh UTSW 5 65,580,695 (GRCm39) splice site probably null
R4913:Ugdh UTSW 5 65,580,791 (GRCm39) critical splice donor site probably null
R5590:Ugdh UTSW 5 65,580,217 (GRCm39) unclassified probably benign
R5644:Ugdh UTSW 5 65,574,204 (GRCm39) missense probably benign 0.04
R5741:Ugdh UTSW 5 65,584,866 (GRCm39) missense probably damaging 0.99
R6151:Ugdh UTSW 5 65,574,924 (GRCm39) nonsense probably null
R6525:Ugdh UTSW 5 65,574,402 (GRCm39) missense probably damaging 1.00
R6897:Ugdh UTSW 5 65,584,776 (GRCm39) missense probably benign 0.07
R7155:Ugdh UTSW 5 65,574,380 (GRCm39) missense probably damaging 1.00
R7692:Ugdh UTSW 5 65,574,958 (GRCm39) missense probably damaging 1.00
R8178:Ugdh UTSW 5 65,581,005 (GRCm39) splice site probably null
R8485:Ugdh UTSW 5 65,584,902 (GRCm39) missense possibly damaging 0.50
R9361:Ugdh UTSW 5 65,575,886 (GRCm39) missense probably damaging 1.00
R9565:Ugdh UTSW 5 65,575,876 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGAGCACTGTTATGGCTTAATGC -3'
(R):5'- TAATGACACAGCATGTTAGAGCC -3'

Sequencing Primer
(F):5'- GCTTAATGCCAAATAAAACCATGG -3'
(R):5'- CCTTCTAAGTGTCAAGACTGCAGG -3'
Posted On 2022-11-14