Incidental Mutation 'R9678:Ugt2b5'
ID 735763
Institutional Source Beutler Lab
Gene Symbol Ugt2b5
Ensembl Gene ENSMUSG00000054630
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms Udpgt-3, m-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 87272819-87288177 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 87273186 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 493 (D493E)
Ref Sequence ENSEMBL: ENSMUSP00000068282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067790]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067790
AA Change: D493E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: D493E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 7.9e-256 PFAM
Pfam:Glyco_tran_28_C 352 449 5.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Ugt2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ugt2b5 APN 5 87,273,078 (GRCm39) missense probably benign 0.02
IGL00742:Ugt2b5 APN 5 87,275,673 (GRCm39) missense probably damaging 1.00
IGL01527:Ugt2b5 APN 5 87,284,068 (GRCm39) missense possibly damaging 0.71
IGL01530:Ugt2b5 APN 5 87,285,104 (GRCm39) missense probably benign 0.08
IGL01637:Ugt2b5 APN 5 87,287,759 (GRCm39) missense probably benign 0.04
IGL02371:Ugt2b5 APN 5 87,275,535 (GRCm39) critical splice donor site probably null
IGL02993:Ugt2b5 APN 5 87,285,091 (GRCm39) missense probably damaging 1.00
IGL03114:Ugt2b5 APN 5 87,276,209 (GRCm39) missense probably damaging 1.00
R0372:Ugt2b5 UTSW 5 87,288,117 (GRCm39) missense probably benign 0.05
R0568:Ugt2b5 UTSW 5 87,285,224 (GRCm39) critical splice acceptor site probably benign
R0650:Ugt2b5 UTSW 5 87,287,627 (GRCm39) missense probably benign 0.00
R1660:Ugt2b5 UTSW 5 87,287,477 (GRCm39) missense probably benign 0.00
R1907:Ugt2b5 UTSW 5 87,287,489 (GRCm39) missense probably benign 0.19
R1955:Ugt2b5 UTSW 5 87,275,631 (GRCm39) missense probably benign 0.18
R2389:Ugt2b5 UTSW 5 87,275,541 (GRCm39) missense probably damaging 0.98
R2435:Ugt2b5 UTSW 5 87,287,465 (GRCm39) missense probably damaging 0.99
R2919:Ugt2b5 UTSW 5 87,273,266 (GRCm39) missense possibly damaging 0.83
R2920:Ugt2b5 UTSW 5 87,273,266 (GRCm39) missense possibly damaging 0.83
R4342:Ugt2b5 UTSW 5 87,287,582 (GRCm39) missense probably damaging 1.00
R4343:Ugt2b5 UTSW 5 87,287,582 (GRCm39) missense probably damaging 1.00
R4344:Ugt2b5 UTSW 5 87,287,582 (GRCm39) missense probably damaging 1.00
R4355:Ugt2b5 UTSW 5 87,287,622 (GRCm39) nonsense probably null
R4380:Ugt2b5 UTSW 5 87,275,753 (GRCm39) missense probably damaging 1.00
R4789:Ugt2b5 UTSW 5 87,287,550 (GRCm39) missense probably benign 0.14
R4993:Ugt2b5 UTSW 5 87,287,532 (GRCm39) missense probably benign 0.00
R5731:Ugt2b5 UTSW 5 87,288,111 (GRCm39) nonsense probably null
R6035:Ugt2b5 UTSW 5 87,287,541 (GRCm39) missense probably benign 0.09
R6035:Ugt2b5 UTSW 5 87,287,541 (GRCm39) missense probably benign 0.09
R6491:Ugt2b5 UTSW 5 87,273,328 (GRCm39) nonsense probably null
R7015:Ugt2b5 UTSW 5 87,287,655 (GRCm39) missense probably damaging 1.00
R7203:Ugt2b5 UTSW 5 87,276,258 (GRCm39) missense possibly damaging 0.72
R7212:Ugt2b5 UTSW 5 87,273,131 (GRCm39) missense probably benign 0.06
R7750:Ugt2b5 UTSW 5 87,288,108 (GRCm39) missense probably benign 0.11
R8384:Ugt2b5 UTSW 5 87,287,924 (GRCm39) missense probably benign
R8465:Ugt2b5 UTSW 5 87,287,518 (GRCm39) missense possibly damaging 0.79
R9336:Ugt2b5 UTSW 5 87,285,130 (GRCm39) missense probably benign 0.00
R9682:Ugt2b5 UTSW 5 87,287,522 (GRCm39) missense probably damaging 0.97
R9727:Ugt2b5 UTSW 5 87,288,165 (GRCm39) start codon destroyed probably damaging 0.97
X0004:Ugt2b5 UTSW 5 87,276,230 (GRCm39) nonsense probably null
X0021:Ugt2b5 UTSW 5 87,284,070 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGTCAAGTGTTTAGAAGGTGGTTC -3'
(R):5'- TCATAGGACAGCTCAATGGATAAG -3'

Sequencing Primer
(F):5'- TGGTTCATAAATAAGAATGAGGCTG -3'
(R):5'- ACATTCATTCCATTAATTGATGGCC -3'
Posted On 2022-11-14