Incidental Mutation 'R9678:Vmn2r14'
ID 735765
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 109362822-109372488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109364041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 625 (L625P)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably damaging
Transcript: ENSMUST00000170341
AA Change: L625P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: L625P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109,364,180 (GRCm39) nonsense probably null
IGL01504:Vmn2r14 APN 5 109,369,285 (GRCm39) missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109,372,443 (GRCm39) missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109,368,275 (GRCm39) missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109,372,349 (GRCm39) missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109,367,933 (GRCm39) missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109,368,454 (GRCm39) nonsense probably null
IGL02676:Vmn2r14 APN 5 109,367,882 (GRCm39) missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109,369,305 (GRCm39) missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109,368,054 (GRCm39) missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109,369,292 (GRCm39) missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109,364,260 (GRCm39) missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109,363,973 (GRCm39) missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109,368,350 (GRCm39) missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109,367,702 (GRCm39) missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109,366,910 (GRCm39) missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109,366,762 (GRCm39) missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109,364,226 (GRCm39) missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109,372,440 (GRCm39) missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109,364,117 (GRCm39) missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109,367,838 (GRCm39) missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109,366,913 (GRCm39) nonsense probably null
R2013:Vmn2r14 UTSW 5 109,369,109 (GRCm39) missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109,366,698 (GRCm39) splice site probably null
R2417:Vmn2r14 UTSW 5 109,372,329 (GRCm39) missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109,363,776 (GRCm39) missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109,372,431 (GRCm39) missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109,364,095 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109,368,033 (GRCm39) missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109,369,370 (GRCm39) missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109,363,976 (GRCm39) missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109,369,384 (GRCm39) splice site probably null
R4896:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109,363,961 (GRCm39) missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109,365,442 (GRCm39) missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109,369,154 (GRCm39) missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109,368,261 (GRCm39) missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109,367,816 (GRCm39) missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109,365,486 (GRCm39) missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109,363,724 (GRCm39) missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109,369,222 (GRCm39) missense probably benign
R5985:Vmn2r14 UTSW 5 109,368,082 (GRCm39) missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109,369,133 (GRCm39) missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109,364,096 (GRCm39) missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109,364,140 (GRCm39) missense probably benign 0.06
R6944:Vmn2r14 UTSW 5 109,363,925 (GRCm39) missense probably benign 0.22
R7608:Vmn2r14 UTSW 5 109,369,276 (GRCm39) missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109,368,086 (GRCm39) missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109,369,219 (GRCm39) missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109,368,420 (GRCm39) missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109,369,342 (GRCm39) missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109,369,340 (GRCm39) missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109,365,533 (GRCm39) missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109,367,893 (GRCm39) missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109,368,054 (GRCm39) missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109,367,902 (GRCm39) nonsense probably null
R9150:Vmn2r14 UTSW 5 109,367,783 (GRCm39) missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109,364,087 (GRCm39) missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109,369,112 (GRCm39) missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109,369,288 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109,368,176 (GRCm39) missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109,368,428 (GRCm39) missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109,367,962 (GRCm39) missense probably benign 0.00
R9774:Vmn2r14 UTSW 5 109,369,126 (GRCm39) missense probably benign 0.07
Z1177:Vmn2r14 UTSW 5 109,367,741 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAGTTAGGTGCCCCTGATGC -3'
(R):5'- GGTGTCCAGATGATAAGTATGCC -3'

Sequencing Primer
(F):5'- CATCTTTCCCCCTGGAGAAGTGAG -3'
(R):5'- CCAGATGATAAGTATGCCAACTTAG -3'
Posted On 2022-11-14