Incidental Mutation 'R9678:Cdkn1c'
ID 735774
Institutional Source Beutler Lab
Gene Symbol Cdkn1c
Ensembl Gene ENSMUSG00000037664
Gene Name cyclin dependent kinase inhibitor 1C
Synonyms Kip2, CDKI, p57Kip2
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.806) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 143012076-143014735 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 143014383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000128828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037287] [ENSMUST00000167912] [ENSMUST00000207910]
AlphaFold P49919
Predicted Effect probably benign
Transcript: ENSMUST00000037287
AA Change: D8G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000037302
Gene: ENSMUSG00000037664
AA Change: D8G

DomainStartEndE-ValueType
Pfam:CDI 20 72 5.7e-20 PFAM
low complexity region 95 107 N/A INTRINSIC
low complexity region 120 147 N/A INTRINSIC
low complexity region 219 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167912
AA Change: D21G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128828
Gene: ENSMUSG00000037664
AA Change: D21G

DomainStartEndE-ValueType
Pfam:CDI 34 84 1.6e-16 PFAM
low complexity region 108 120 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 232 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207910
Predicted Effect probably benign
Transcript: ENSMUST00000208137
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants or heterozygotes with a mutant maternal allele have developmental defects including cleft palate, gastrointestinal defects and short limbs. Most mutants die at birth; survivors are growth retarded and have immature reproductive systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Cdkn1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
bubbly UTSW 7 143,014,326 (GRCm39) missense possibly damaging 0.95
exuberant UTSW 7 143,013,531 (GRCm39) critical splice donor site probably benign
R1768:Cdkn1c UTSW 7 143,012,858 (GRCm39) missense probably benign 0.27
R3617:Cdkn1c UTSW 7 143,013,531 (GRCm39) critical splice donor site probably benign
R7111:Cdkn1c UTSW 7 143,014,326 (GRCm39) missense possibly damaging 0.95
R7360:Cdkn1c UTSW 7 143,014,431 (GRCm39) missense possibly damaging 0.83
R7665:Cdkn1c UTSW 7 143,014,371 (GRCm39) missense possibly damaging 0.47
R8463:Cdkn1c UTSW 7 143,014,324 (GRCm39) missense possibly damaging 0.94
R9051:Cdkn1c UTSW 7 143,013,964 (GRCm39) missense possibly damaging 0.73
Z1177:Cdkn1c UTSW 7 143,014,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCACTGCAGACGACCAGG -3'
(R):5'- TCACCAATCAGCCAGGTAGC -3'

Sequencing Primer
(F):5'- ACGACCAGGGCCTCGAAG -3'
(R):5'- AATCAGCCAGGTAGCCGCTG -3'
Posted On 2022-11-14