Incidental Mutation 'R9678:Atr'
ID 735775
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Name ataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 95739650-95833834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95792610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1644 (A1644V)
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: A1638V

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000215311
AA Change: A1644V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95,747,105 (GRCm39) missense probably damaging 1.00
IGL00922:Atr APN 9 95,789,398 (GRCm39) missense probably damaging 0.97
IGL01020:Atr APN 9 95,744,836 (GRCm39) missense probably damaging 1.00
IGL01345:Atr APN 9 95,823,002 (GRCm39) missense probably damaging 1.00
IGL01364:Atr APN 9 95,747,677 (GRCm39) missense probably benign 0.29
IGL01456:Atr APN 9 95,832,618 (GRCm39) missense possibly damaging 0.62
IGL01534:Atr APN 9 95,747,599 (GRCm39) missense probably damaging 0.99
IGL01761:Atr APN 9 95,833,501 (GRCm39) splice site probably benign
IGL01791:Atr APN 9 95,803,834 (GRCm39) missense probably benign 0.05
IGL01831:Atr APN 9 95,752,807 (GRCm39) missense probably benign 0.18
IGL01973:Atr APN 9 95,753,727 (GRCm39) missense probably damaging 1.00
IGL02008:Atr APN 9 95,763,473 (GRCm39) splice site probably benign
IGL02016:Atr APN 9 95,809,228 (GRCm39) missense probably benign 0.09
IGL02035:Atr APN 9 95,748,735 (GRCm39) missense probably benign 0.01
IGL02058:Atr APN 9 95,753,540 (GRCm39) missense probably damaging 0.99
IGL02081:Atr APN 9 95,765,258 (GRCm39) missense probably damaging 1.00
IGL02224:Atr APN 9 95,760,682 (GRCm39) missense probably damaging 0.98
IGL02234:Atr APN 9 95,829,303 (GRCm39) splice site probably benign
IGL02367:Atr APN 9 95,781,194 (GRCm39) nonsense probably null
IGL02621:Atr APN 9 95,790,453 (GRCm39) missense probably benign 0.00
IGL02728:Atr APN 9 95,818,528 (GRCm39) missense probably damaging 1.00
IGL02833:Atr APN 9 95,744,905 (GRCm39) missense probably damaging 1.00
IGL02939:Atr APN 9 95,747,314 (GRCm39) missense probably benign
IGL03107:Atr APN 9 95,779,783 (GRCm39) missense probably benign 0.28
IGL03382:Atr APN 9 95,802,875 (GRCm39) nonsense probably null
PIT4812001:Atr UTSW 9 95,792,702 (GRCm39) missense probably benign 0.41
R0042:Atr UTSW 9 95,809,409 (GRCm39) splice site probably benign
R0042:Atr UTSW 9 95,809,409 (GRCm39) splice site probably benign
R0281:Atr UTSW 9 95,819,619 (GRCm39) missense probably benign 0.26
R0282:Atr UTSW 9 95,744,851 (GRCm39) missense probably benign 0.12
R0512:Atr UTSW 9 95,817,579 (GRCm39) missense probably damaging 0.99
R0547:Atr UTSW 9 95,781,218 (GRCm39) splice site probably benign
R0567:Atr UTSW 9 95,747,882 (GRCm39) missense probably benign 0.00
R0631:Atr UTSW 9 95,756,830 (GRCm39) missense possibly damaging 0.92
R1116:Atr UTSW 9 95,749,689 (GRCm39) nonsense probably null
R1171:Atr UTSW 9 95,789,376 (GRCm39) missense probably damaging 1.00
R1241:Atr UTSW 9 95,832,689 (GRCm39) missense probably benign 0.08
R1345:Atr UTSW 9 95,802,408 (GRCm39) missense probably benign 0.25
R1400:Atr UTSW 9 95,744,901 (GRCm39) missense probably benign 0.32
R1413:Atr UTSW 9 95,814,495 (GRCm39) missense probably damaging 1.00
R1527:Atr UTSW 9 95,752,096 (GRCm39) missense possibly damaging 0.82
R1557:Atr UTSW 9 95,753,502 (GRCm39) missense probably damaging 1.00
R1591:Atr UTSW 9 95,827,438 (GRCm39) missense probably damaging 1.00
R1602:Atr UTSW 9 95,833,610 (GRCm39) missense probably damaging 1.00
R1605:Atr UTSW 9 95,818,516 (GRCm39) missense probably damaging 1.00
R1670:Atr UTSW 9 95,743,509 (GRCm39) missense probably benign 0.38
R1709:Atr UTSW 9 95,753,129 (GRCm39) missense probably benign 0.00
R1728:Atr UTSW 9 95,779,634 (GRCm39) missense probably benign 0.01
R1729:Atr UTSW 9 95,779,634 (GRCm39) missense probably benign 0.01
R1739:Atr UTSW 9 95,779,634 (GRCm39) missense probably benign 0.01
R1816:Atr UTSW 9 95,748,747 (GRCm39) missense probably benign 0.00
R1824:Atr UTSW 9 95,818,474 (GRCm39) missense probably damaging 1.00
R1844:Atr UTSW 9 95,787,870 (GRCm39) missense probably benign 0.01
R1857:Atr UTSW 9 95,747,150 (GRCm39) missense probably damaging 1.00
R1858:Atr UTSW 9 95,747,150 (GRCm39) missense probably damaging 1.00
R1866:Atr UTSW 9 95,752,658 (GRCm39) splice site probably null
R1913:Atr UTSW 9 95,748,786 (GRCm39) missense probably benign 0.01
R2042:Atr UTSW 9 95,752,075 (GRCm39) missense probably benign 0.00
R2210:Atr UTSW 9 95,789,353 (GRCm39) missense probably damaging 1.00
R2230:Atr UTSW 9 95,802,818 (GRCm39) missense probably damaging 1.00
R2361:Atr UTSW 9 95,753,210 (GRCm39) missense probably benign 0.41
R2399:Atr UTSW 9 95,753,652 (GRCm39) missense probably benign 0.00
R2431:Atr UTSW 9 95,744,945 (GRCm39) missense probably benign 0.24
R2860:Atr UTSW 9 95,756,296 (GRCm39) missense probably benign 0.07
R2861:Atr UTSW 9 95,756,296 (GRCm39) missense probably benign 0.07
R3019:Atr UTSW 9 95,787,871 (GRCm39) missense possibly damaging 0.52
R3684:Atr UTSW 9 95,802,453 (GRCm39) missense probably damaging 0.96
R4155:Atr UTSW 9 95,770,177 (GRCm39) nonsense probably null
R4295:Atr UTSW 9 95,756,479 (GRCm39) missense probably benign 0.04
R4359:Atr UTSW 9 95,833,589 (GRCm39) missense probably damaging 1.00
R4506:Atr UTSW 9 95,747,290 (GRCm39) missense probably benign 0.21
R4523:Atr UTSW 9 95,744,916 (GRCm39) missense probably damaging 1.00
R4536:Atr UTSW 9 95,756,471 (GRCm39) missense probably benign 0.26
R4588:Atr UTSW 9 95,747,720 (GRCm39) missense probably benign
R4646:Atr UTSW 9 95,753,250 (GRCm39) critical splice donor site probably null
R4702:Atr UTSW 9 95,802,408 (GRCm39) missense possibly damaging 0.92
R4743:Atr UTSW 9 95,744,845 (GRCm39) missense probably benign 0.14
R4782:Atr UTSW 9 95,744,850 (GRCm39) missense probably benign 0.00
R4928:Atr UTSW 9 95,789,352 (GRCm39) missense probably damaging 1.00
R5031:Atr UTSW 9 95,747,755 (GRCm39) missense probably damaging 0.98
R5138:Atr UTSW 9 95,819,649 (GRCm39) missense probably benign 0.15
R5188:Atr UTSW 9 95,803,778 (GRCm39) missense probably benign 0.00
R5219:Atr UTSW 9 95,763,291 (GRCm39) missense probably damaging 0.99
R5307:Atr UTSW 9 95,760,597 (GRCm39) missense probably benign 0.01
R5414:Atr UTSW 9 95,752,757 (GRCm39) missense probably benign 0.00
R5628:Atr UTSW 9 95,756,279 (GRCm39) nonsense probably null
R5664:Atr UTSW 9 95,787,866 (GRCm39) missense probably benign 0.00
R5678:Atr UTSW 9 95,833,540 (GRCm39) nonsense probably null
R5724:Atr UTSW 9 95,748,641 (GRCm39) missense probably damaging 1.00
R5759:Atr UTSW 9 95,756,455 (GRCm39) missense probably benign 0.01
R5763:Atr UTSW 9 95,827,176 (GRCm39) missense probably benign 0.04
R5922:Atr UTSW 9 95,785,735 (GRCm39) missense probably benign 0.00
R6051:Atr UTSW 9 95,790,422 (GRCm39) missense possibly damaging 0.85
R6161:Atr UTSW 9 95,747,372 (GRCm39) missense probably benign
R6171:Atr UTSW 9 95,763,324 (GRCm39) nonsense probably null
R6532:Atr UTSW 9 95,790,461 (GRCm39) missense probably benign
R6774:Atr UTSW 9 95,809,266 (GRCm39) missense probably benign 0.00
R6894:Atr UTSW 9 95,809,250 (GRCm39) missense probably damaging 1.00
R6930:Atr UTSW 9 95,748,688 (GRCm39) missense probably benign 0.21
R7018:Atr UTSW 9 95,748,747 (GRCm39) missense probably benign 0.17
R7056:Atr UTSW 9 95,744,916 (GRCm39) missense probably damaging 1.00
R7103:Atr UTSW 9 95,747,425 (GRCm39) missense probably damaging 0.98
R7154:Atr UTSW 9 95,747,098 (GRCm39) missense probably benign
R7157:Atr UTSW 9 95,751,953 (GRCm39) missense probably benign 0.00
R7188:Atr UTSW 9 95,744,844 (GRCm39) nonsense probably null
R7189:Atr UTSW 9 95,744,844 (GRCm39) nonsense probably null
R7300:Atr UTSW 9 95,747,423 (GRCm39) missense probably benign 0.00
R7337:Atr UTSW 9 95,753,501 (GRCm39) missense probably damaging 1.00
R7584:Atr UTSW 9 95,824,766 (GRCm39) missense probably damaging 1.00
R7602:Atr UTSW 9 95,789,436 (GRCm39) missense possibly damaging 0.64
R7633:Atr UTSW 9 95,829,171 (GRCm39) missense probably damaging 1.00
R7640:Atr UTSW 9 95,789,346 (GRCm39) splice site probably null
R7677:Atr UTSW 9 95,767,515 (GRCm39) missense probably damaging 1.00
R7699:Atr UTSW 9 95,757,743 (GRCm39) nonsense probably null
R7700:Atr UTSW 9 95,757,743 (GRCm39) nonsense probably null
R7790:Atr UTSW 9 95,756,233 (GRCm39) missense probably damaging 1.00
R8027:Atr UTSW 9 95,747,809 (GRCm39) missense probably damaging 0.99
R8147:Atr UTSW 9 95,781,113 (GRCm39) missense probably damaging 1.00
R8204:Atr UTSW 9 95,817,566 (GRCm39) missense
R8306:Atr UTSW 9 95,802,423 (GRCm39) missense
R8462:Atr UTSW 9 95,749,579 (GRCm39) missense probably benign
R8716:Atr UTSW 9 95,789,468 (GRCm39) missense probably benign 0.09
R8748:Atr UTSW 9 95,814,476 (GRCm39) missense probably benign 0.00
R8795:Atr UTSW 9 95,749,584 (GRCm39) missense probably damaging 1.00
R8891:Atr UTSW 9 95,787,813 (GRCm39) missense probably benign 0.03
R8976:Atr UTSW 9 95,772,819 (GRCm39) missense probably benign 0.00
R9024:Atr UTSW 9 95,789,416 (GRCm39) missense possibly damaging 0.93
R9116:Atr UTSW 9 95,747,851 (GRCm39) missense probably benign 0.00
R9523:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9524:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9525:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9527:Atr UTSW 9 95,767,429 (GRCm39) missense probably damaging 1.00
R9563:Atr UTSW 9 95,802,833 (GRCm39) missense probably damaging 0.98
R9629:Atr UTSW 9 95,747,098 (GRCm39) missense probably benign
R9642:Atr UTSW 9 95,821,294 (GRCm39) missense probably damaging 1.00
R9652:Atr UTSW 9 95,756,887 (GRCm39) missense probably damaging 1.00
R9660:Atr UTSW 9 95,797,050 (GRCm39) missense probably benign 0.40
R9728:Atr UTSW 9 95,797,050 (GRCm39) missense probably benign 0.40
R9731:Atr UTSW 9 95,747,092 (GRCm39) missense possibly damaging 0.52
R9732:Atr UTSW 9 95,743,438 (GRCm39) missense probably damaging 1.00
R9749:Atr UTSW 9 95,819,703 (GRCm39) critical splice donor site probably null
X0019:Atr UTSW 9 95,822,924 (GRCm39) missense probably damaging 1.00
Z1088:Atr UTSW 9 95,767,373 (GRCm39) splice site probably null
Z1177:Atr UTSW 9 95,770,153 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCTGAGCAGACATCTTGTACTTC -3'
(R):5'- GTACCTAAGAGTGTCTGGAATAGTC -3'

Sequencing Primer
(F):5'- GCAGACATCTTGTACTTCATTAAGAC -3'
(R):5'- GTCAATAAAAAGAACATGTCACCAC -3'
Posted On 2022-11-14