Incidental Mutation 'R9678:Or1i2'
ID 735778
Institutional Source Beutler Lab
Gene Symbol Or1i2
Ensembl Gene ENSMUSG00000071185
Gene Name olfactory receptor family 1 subfamily I member 1
Synonyms GA_x6K02T2QGN0-3196801-3197742, MOR128-3, MOR128-4, Olfr1357
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 78447503-78453908 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78447717 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 253 (G253R)
Ref Sequence ENSEMBL: ENSMUSP00000093127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095473] [ENSMUST00000203305] [ENSMUST00000205085] [ENSMUST00000213877]
AlphaFold Q7TQU7
Predicted Effect probably damaging
Transcript: ENSMUST00000095473
AA Change: G253R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093127
Gene: ENSMUSG00000071185
AA Change: G253R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203305
AA Change: G253R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145032
Gene: ENSMUSG00000071185
AA Change: G253R

DomainStartEndE-ValueType
Pfam:7tm_4 31 235 1.3e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 215 7.7e-11 PFAM
Pfam:7tm_1 41 234 3.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205085
AA Change: G253R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145185
Gene: ENSMUSG00000071185
AA Change: G253R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213877
AA Change: G253R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Or1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Or1i2 APN 10 78,447,960 (GRCm39) missense probably benign 0.02
IGL02201:Or1i2 APN 10 78,448,104 (GRCm39) missense probably damaging 0.96
IGL03029:Or1i2 APN 10 78,447,792 (GRCm39) missense probably benign 0.14
IGL03094:Or1i2 APN 10 78,447,953 (GRCm39) missense possibly damaging 0.80
R0207:Or1i2 UTSW 10 78,447,705 (GRCm39) missense probably benign
R0563:Or1i2 UTSW 10 78,448,467 (GRCm39) missense probably benign
R0745:Or1i2 UTSW 10 78,447,956 (GRCm39) missense probably benign 0.02
R1607:Or1i2 UTSW 10 78,447,974 (GRCm39) missense probably benign 0.08
R2419:Or1i2 UTSW 10 78,448,221 (GRCm39) missense probably benign 0.34
R4198:Or1i2 UTSW 10 78,447,901 (GRCm39) missense possibly damaging 0.69
R4199:Or1i2 UTSW 10 78,447,901 (GRCm39) missense possibly damaging 0.69
R4200:Or1i2 UTSW 10 78,447,901 (GRCm39) missense possibly damaging 0.69
R4619:Or1i2 UTSW 10 78,448,409 (GRCm39) missense probably benign
R6152:Or1i2 UTSW 10 78,448,409 (GRCm39) missense probably benign
R6836:Or1i2 UTSW 10 78,448,424 (GRCm39) missense probably damaging 1.00
R6843:Or1i2 UTSW 10 78,447,891 (GRCm39) missense probably damaging 1.00
R7266:Or1i2 UTSW 10 78,448,448 (GRCm39) missense probably benign 0.07
R8104:Or1i2 UTSW 10 78,448,242 (GRCm39) missense probably benign 0.29
R8765:Or1i2 UTSW 10 78,448,429 (GRCm39) missense probably benign 0.01
R8795:Or1i2 UTSW 10 78,447,698 (GRCm39) missense probably damaging 1.00
R8806:Or1i2 UTSW 10 78,447,974 (GRCm39) missense probably benign 0.08
R8842:Or1i2 UTSW 10 78,447,635 (GRCm39) missense possibly damaging 0.95
R9640:Or1i2 UTSW 10 78,448,311 (GRCm39) missense probably damaging 1.00
Z1176:Or1i2 UTSW 10 78,447,890 (GRCm39) missense probably damaging 1.00
Z1177:Or1i2 UTSW 10 78,447,985 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGCACTAGGACTGGAATGAGAC -3'
(R):5'- GACCTTATGCCCCTCCTGAAAC -3'

Sequencing Primer
(F):5'- AATGAGACTGCTTTGCTGCCAAG -3'
(R):5'- ACACATCAATGAGCTGGTGATC -3'
Posted On 2022-11-14