Mutagenetix > Incidental Mutation

Incidental Mutation 'R9678:Slfn8'

735780

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R9678 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83016897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 273 (I273M)

Ref Sequence

ENSEMBL: ENSMUSP00000040060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

AlphaFold

B1ARD8

Predicted Effect

probably damaging
Transcript: ENSMUST00000038141
AA Change: I273M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: I273M

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000092838
AA Change: I273M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: I273M

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108152
AA Change: I273M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: I273M

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130822
AA Change: I273M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: I273M

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: I94M

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000215239
AA Change: I273M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	A	G	17: 57,443,997	N557S	probably damaging	Het
Atr	C	T	9: 95,910,557	A1644V	possibly damaging	Het
C4b	A	G	17: 34,741,789		probably null	Het
Cdca2	A	T	14: 67,700,329	C292S	unknown	Het
Cdkn1c	T	C	7: 143,460,646	D21G	probably benign	Het
Clec12a	C	A	6: 129,353,665	T70K	probably benign	Het
Crnkl1	A	T	2: 145,919,955	S561T	probably benign	Het
Dock4	TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC	TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC	12: 40,844,380		probably benign	Het
Dock4	TGCCGG	TGCCGGCGCCGG	12: 40,844,388		probably benign	Het
Dock4	CGGTGC	CGGTGCGGGTGC	12: 40,844,397		probably benign	Het
Ehbp1	T	C	11: 22,151,108	D274G	possibly damaging	Het
Fsd2	T	C	7: 81,559,701	Y131C	probably damaging	Het
Gm10153	C	A	7: 142,189,986	C115F	unknown	Het
Gm10376	A	T	14: 43,015,567	M1K	probably null	Het
Gm10837	A	T	14: 122,491,026	K105*	probably null	Het
H3f3a	A	G	1: 180,810,115		probably null	Het
Igkv10-96	T	A	6: 68,632,240	M24L	probably benign	Het
Inpp4a	T	C	1: 37,366,871	S157P	probably damaging	Het
Meaf6	A	G	4: 125,102,896	N133S	possibly damaging	Het
Nphp3	T	C	9: 104,023,487	V648A	possibly damaging	Het
Olfr1357	C	T	10: 78,611,883	G253R	probably damaging	Het
Olfr181	A	G	16: 58,926,277	M98T	probably benign	Het
Parm1	A	G	5: 91,594,285	T171A	possibly damaging	Het
Pik3r1	G	T	13: 101,702,781	R188S	probably damaging	Het
Rbsn	T	C	6: 92,211,638	H32R	probably damaging	Het
Sdk2	G	T	11: 113,794,963	Y1910*	probably null	Het
Sult1a1	C	T	7: 126,674,364	V132I	probably benign	Het
Tagln3	T	A	16: 45,724,242	Y22F	probably damaging	Het
Tenm4	A	G	7: 96,737,412	E575G	possibly damaging	Het
Trim24	T	C	6: 37,965,514	V987A	probably damaging	Het
Trpm7	C	A	2: 126,844,370	V313F	probably damaging	Het
Trub1	A	T	19: 57,458,117	N93I	probably benign	Het
Ugdh	A	G	5: 65,424,127	V60A	possibly damaging	Het
Ugt2b5	A	C	5: 87,125,327	D493E	probably damaging	Het
Utrn	G	T	10: 12,739,415	D337E	probably benign	Het
Vmn2r14	A	G	5: 109,216,175	L625P	probably damaging	Het
Vmn2r89	A	G	14: 51,456,054	D287G	probably benign	Het
Xirp2	A	T	2: 67,509,444	E676D	possibly damaging	Het
Zbbx	A	G	3: 75,139,534	L26P	probably damaging	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
seven_dwarfs	UTSW	11	83003334	missense	probably benign	0.09
vanwinkle	UTSW	11	83017393	missense	probably damaging	1.00
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0368:Slfn8	UTSW	11	83017132	missense	probably damaging	1.00
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4767:Slfn8	UTSW	11	83003197	missense	possibly damaging	0.66
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5617:Slfn8	UTSW	11	83004721	missense	probably benign	0.01
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5886:Slfn8	UTSW	11	83003334	missense	probably benign	0.09
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6419:Slfn8	UTSW	11	83004055	splice site	probably null
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
R8425:Slfn8	UTSW	11	83004615	missense	possibly damaging	0.80
R8517:Slfn8	UTSW	11	83004142	missense	possibly damaging	0.68
R8804:Slfn8	UTSW	11	83016813	missense	possibly damaging	0.94
R8814:Slfn8	UTSW	11	83016679	missense	possibly damaging	0.95
R9069:Slfn8	UTSW	11	83017076	missense	probably damaging	1.00
R9233:Slfn8	UTSW	11	83003596	missense	probably damaging	1.00
R9457:Slfn8	UTSW	11	83017706	missense	probably benign
R9708:Slfn8	UTSW	11	83003441	missense	probably benign	0.00
R9764:Slfn8	UTSW	11	83017012	missense	probably damaging	1.00
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69
Z1177:Slfn8	UTSW	11	83003533	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CCATGAAATGGGAGCCTCTGAG -3'
(R):5'- TTGAATATGGCCAATGCTTGC -3'

Sequencing Primer
(F):5'- TGGGAGCCTCTGAGAACACTG -3'
(R):5'- GAATATGGCCAATGCTTGCTTTTC -3'

Posted On

2022-11-14