Incidental Mutation 'R9678:Gm10376'
ID 735786
Institutional Source Beutler Lab
Gene Symbol Gm10376
Ensembl Gene ENSMUSG00000072605
Gene Name predicted gene 10376
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Not available question?
Stock # R9678 (G1)
Quality Score 173.009
Status Not validated
Chromosome 14
Chromosomal Location 42867646-42873085 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 42873024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000128599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100694] [ENSMUST00000169756]
AlphaFold D3YXI8
Predicted Effect probably benign
Transcript: ENSMUST00000100694
SMART Domains Protein: ENSMUSP00000098259
Gene: ENSMUSG00000072605

DomainStartEndE-ValueType
Pfam:Takusan 8 89 1.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169756
AA Change: M1K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128599
Gene: ENSMUSG00000072605
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Takusan 8 89 1.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Gm10376
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6548:Gm10376 UTSW 14 42,873,025 (GRCm39) start codon destroyed probably null 0.02
R7135:Gm10376 UTSW 14 42,867,950 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAGGCCATATTCCTGCAAGG -3'
(R):5'- AGACTCCAGGAAAGGGCACTTC -3'

Sequencing Primer
(F):5'- AGGTAGCTCCCCCAACCTTG -3'
(R):5'- GGGCACTTCAAAAACTGGTC -3'
Posted On 2022-11-14