Incidental Mutation 'R9678:Cdca2'
ID 735788
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Name cell division cycle associated 2
Synonyms 2610311M19Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 67913780-67953290 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67937778 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 292 (C292S)
Ref Sequence ENSEMBL: ENSMUSP00000117847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124045] [ENSMUST00000132705] [ENSMUST00000150006] [ENSMUST00000163100]
AlphaFold Q14B71
Predicted Effect unknown
Transcript: ENSMUST00000124045
AA Change: C292S
Predicted Effect probably benign
Transcript: ENSMUST00000130922
Predicted Effect probably benign
Transcript: ENSMUST00000131179
SMART Domains Protein: ENSMUSP00000123664
Gene: ENSMUSG00000048922

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132705
AA Change: C292S
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: C292S

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150006
AA Change: C292S
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: C292S

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163100
AA Change: C292S
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: C292S

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67,952,146 (GRCm39) missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67,915,343 (GRCm39) missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67,943,172 (GRCm39) missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67,915,168 (GRCm39) missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67,932,445 (GRCm39) missense probably benign 0.00
IGL02208:Cdca2 APN 14 67,950,589 (GRCm39) missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67,944,946 (GRCm39) missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67,952,385 (GRCm39) splice site probably benign
F5493:Cdca2 UTSW 14 67,915,141 (GRCm39) missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67,937,471 (GRCm39) intron probably benign
R0254:Cdca2 UTSW 14 67,914,627 (GRCm39) missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67,950,568 (GRCm39) missense probably benign 0.02
R0368:Cdca2 UTSW 14 67,937,796 (GRCm39) missense possibly damaging 0.89
R0398:Cdca2 UTSW 14 67,935,411 (GRCm39) missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67,917,740 (GRCm39) missense probably benign
R1104:Cdca2 UTSW 14 67,931,131 (GRCm39) missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67,952,355 (GRCm39) intron probably benign
R1658:Cdca2 UTSW 14 67,915,148 (GRCm39) missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67,915,260 (GRCm39) missense probably benign 0.22
R2150:Cdca2 UTSW 14 67,952,258 (GRCm39) missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67,914,425 (GRCm39) missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67,952,287 (GRCm39) missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67,935,539 (GRCm39) missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67,935,612 (GRCm39) missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67,917,720 (GRCm39) nonsense probably null
R4043:Cdca2 UTSW 14 67,941,455 (GRCm39) missense probably benign 0.11
R4293:Cdca2 UTSW 14 67,952,299 (GRCm39) missense probably benign 0.06
R4679:Cdca2 UTSW 14 67,952,415 (GRCm39) missense possibly damaging 0.68
R4777:Cdca2 UTSW 14 67,950,589 (GRCm39) missense probably damaging 0.99
R4829:Cdca2 UTSW 14 67,931,202 (GRCm39) critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67,914,425 (GRCm39) missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67,950,602 (GRCm39) missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67,917,614 (GRCm39) missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67,914,920 (GRCm39) missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67,917,733 (GRCm39) missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67,943,078 (GRCm39) critical splice donor site probably null
R6246:Cdca2 UTSW 14 67,915,277 (GRCm39) nonsense probably null
R6866:Cdca2 UTSW 14 67,931,115 (GRCm39) missense possibly damaging 0.92
R6928:Cdca2 UTSW 14 67,943,193 (GRCm39) missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67,952,453 (GRCm39) start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67,932,446 (GRCm39) missense probably benign 0.27
R7080:Cdca2 UTSW 14 67,935,551 (GRCm39) missense probably damaging 0.99
R7092:Cdca2 UTSW 14 67,944,800 (GRCm39) critical splice donor site probably null
R7292:Cdca2 UTSW 14 67,915,326 (GRCm39) nonsense probably null
R7308:Cdca2 UTSW 14 67,932,440 (GRCm39) missense probably benign
R7310:Cdca2 UTSW 14 67,950,673 (GRCm39) missense probably damaging 1.00
R7877:Cdca2 UTSW 14 67,914,665 (GRCm39) missense probably benign
R8012:Cdca2 UTSW 14 67,914,821 (GRCm39) missense probably benign 0.23
R8080:Cdca2 UTSW 14 67,915,004 (GRCm39) nonsense probably null
R8772:Cdca2 UTSW 14 67,935,529 (GRCm39) missense probably damaging 0.98
R9123:Cdca2 UTSW 14 67,917,762 (GRCm39) missense probably benign 0.03
R9125:Cdca2 UTSW 14 67,917,762 (GRCm39) missense probably benign 0.03
R9252:Cdca2 UTSW 14 67,914,831 (GRCm39) missense possibly damaging 0.93
R9328:Cdca2 UTSW 14 67,931,131 (GRCm39) missense probably damaging 0.99
R9406:Cdca2 UTSW 14 67,937,772 (GRCm39) missense unknown
R9667:Cdca2 UTSW 14 67,915,003 (GRCm39) missense probably benign 0.01
Z1088:Cdca2 UTSW 14 67,937,747 (GRCm39) missense probably benign 0.12
Z1177:Cdca2 UTSW 14 67,917,693 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACTCCTTCGCTTTAGGAAG -3'
(R):5'- GCAATACTGCTAGCACTTGGG -3'

Sequencing Primer
(F):5'- TTAGGAAGCGTGACTCTTACC -3'
(R):5'- TGAGCTCCATTCACTAGCGG -3'
Posted On 2022-11-14