Incidental Mutation 'R9678:Tagln3'
ID 735790
Institutional Source Beutler Lab
Gene Symbol Tagln3
Ensembl Gene ENSMUSG00000022658
Gene Name transgelin 3
Synonyms 2900005O10Rik, Np25, 2700038H05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45531593-45544971 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45544605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 22 (Y22F)
Ref Sequence ENSEMBL: ENSMUSP00000093762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096057]
AlphaFold Q9R1Q8
Predicted Effect probably damaging
Transcript: ENSMUST00000096057
AA Change: Y22F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093762
Gene: ENSMUSG00000022658
AA Change: Y22F

DomainStartEndE-ValueType
CH 26 132 4.3e-24 SMART
Pfam:Calponin 174 198 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Or5k17 A G 16: 58,746,640 (GRCm39) M98T probably benign Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Tagln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Tagln3 APN 16 45,544,556 (GRCm39) nonsense probably null
IGL02640:Tagln3 APN 16 45,544,596 (GRCm39) missense probably benign 0.00
IGL02715:Tagln3 APN 16 45,544,588 (GRCm39) missense probably benign
R0619:Tagln3 UTSW 16 45,544,635 (GRCm39) missense probably damaging 0.99
R1118:Tagln3 UTSW 16 45,544,635 (GRCm39) missense probably damaging 0.99
R1119:Tagln3 UTSW 16 45,544,635 (GRCm39) missense probably damaging 0.99
R1865:Tagln3 UTSW 16 45,532,013 (GRCm39) missense possibly damaging 0.89
R2111:Tagln3 UTSW 16 45,531,957 (GRCm39) missense probably damaging 1.00
R6242:Tagln3 UTSW 16 45,544,701 (GRCm39) start gained probably benign
R6329:Tagln3 UTSW 16 45,533,365 (GRCm39) missense probably benign 0.03
R6857:Tagln3 UTSW 16 45,544,599 (GRCm39) missense probably benign
R6995:Tagln3 UTSW 16 45,543,321 (GRCm39) missense probably benign 0.01
R7398:Tagln3 UTSW 16 45,543,440 (GRCm39) missense probably damaging 1.00
R8144:Tagln3 UTSW 16 45,544,554 (GRCm39) missense probably benign 0.00
X0026:Tagln3 UTSW 16 45,543,460 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCATGCTCATCTCTCCC -3'
(R):5'- GATTTTAAACCACGCCCGGC -3'

Sequencing Primer
(F):5'- TGGCAACAGGGGATCTCC -3'
(R):5'- CCGCTTTGCTGCTGCTGG -3'
Posted On 2022-11-14