Incidental Mutation 'R9678:Or5k17'
ID 735791
Institutional Source Beutler Lab
Gene Symbol Or5k17
Ensembl Gene ENSMUSG00000090951
Gene Name olfactory receptor family 5 subfamily K member 17
Synonyms Olfr181, MOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9678 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 58745920-58749007 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58746640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 98 (M98T)
Ref Sequence ENSEMBL: ENSMUSP00000074825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
AlphaFold Q8VGQ7
Predicted Effect probably benign
Transcript: ENSMUST00000075361
AA Change: M98T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: M98T

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
AA Change: M98T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000205742
AA Change: M98T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000205986
AA Change: M98T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,750,997 (GRCm39) N557S probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
C4b A G 17: 34,960,763 (GRCm39) probably null Het
Cdca2 A T 14: 67,937,778 (GRCm39) C292S unknown Het
Cdkn1c T C 7: 143,014,383 (GRCm39) D21G probably benign Het
Clec12a C A 6: 129,330,628 (GRCm39) T70K probably benign Het
Crnkl1 A T 2: 145,761,875 (GRCm39) S561T probably benign Het
Dock4 TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC 12: 40,894,379 (GRCm39) probably benign Het
Dock4 CGGTGC CGGTGCGGGTGC 12: 40,894,396 (GRCm39) probably benign Het
Dock4 TGCCGG TGCCGGCGCCGG 12: 40,894,387 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,101,108 (GRCm39) D274G possibly damaging Het
Fsd2 T C 7: 81,209,449 (GRCm39) Y131C probably damaging Het
Gm10153 C A 7: 141,743,723 (GRCm39) C115F unknown Het
Gm10376 A T 14: 42,873,024 (GRCm39) M1K probably null Het
Gm10837 A T 14: 122,728,438 (GRCm39) K105* probably null Het
H3f3a A G 1: 180,637,680 (GRCm39) probably null Het
Igkv10-96 T A 6: 68,609,224 (GRCm39) M24L probably benign Het
Inpp4a T C 1: 37,405,952 (GRCm39) S157P probably damaging Het
Meaf6 A G 4: 124,996,689 (GRCm39) N133S possibly damaging Het
Nphp3 T C 9: 103,900,686 (GRCm39) V648A possibly damaging Het
Or1i2 C T 10: 78,447,717 (GRCm39) G253R probably damaging Het
Parm1 A G 5: 91,742,144 (GRCm39) T171A possibly damaging Het
Pik3r1 G T 13: 101,839,289 (GRCm39) R188S probably damaging Het
Rbsn T C 6: 92,188,619 (GRCm39) H32R probably damaging Het
Sdk2 G T 11: 113,685,789 (GRCm39) Y1910* probably null Het
Slfn8 T C 11: 82,907,723 (GRCm39) I273M probably damaging Het
Sult1a1 C T 7: 126,273,536 (GRCm39) V132I probably benign Het
Tagln3 T A 16: 45,544,605 (GRCm39) Y22F probably damaging Het
Tenm4 A G 7: 96,386,619 (GRCm39) E575G possibly damaging Het
Trim24 T C 6: 37,942,449 (GRCm39) V987A probably damaging Het
Trpm7 C A 2: 126,686,290 (GRCm39) V313F probably damaging Het
Trub1 A T 19: 57,446,549 (GRCm39) N93I probably benign Het
Ugdh A G 5: 65,581,470 (GRCm39) V60A possibly damaging Het
Ugt2b5 A C 5: 87,273,186 (GRCm39) D493E probably damaging Het
Utrn G T 10: 12,615,159 (GRCm39) D337E probably benign Het
Vmn2r14 A G 5: 109,364,041 (GRCm39) L625P probably damaging Het
Vmn2r89 A G 14: 51,693,511 (GRCm39) D287G probably benign Het
Xirp2 A T 2: 67,339,788 (GRCm39) E676D possibly damaging Het
Zbbx A G 3: 75,046,841 (GRCm39) L26P probably damaging Het
Other mutations in Or5k17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Or5k17 APN 16 58,746,929 (GRCm39) missense probably benign
IGL02477:Or5k17 APN 16 58,746,126 (GRCm39) missense probably benign 0.07
IGL02545:Or5k17 APN 16 58,746,833 (GRCm39) missense possibly damaging 0.88
IGL02690:Or5k17 APN 16 58,746,214 (GRCm39) missense possibly damaging 0.78
IGL02718:Or5k17 APN 16 58,746,459 (GRCm39) missense possibly damaging 0.57
IGL02945:Or5k17 APN 16 58,746,703 (GRCm39) missense probably damaging 1.00
IGL03349:Or5k17 APN 16 58,746,323 (GRCm39) missense probably benign 0.00
B5639:Or5k17 UTSW 16 58,746,889 (GRCm39) missense probably benign 0.00
R0550:Or5k17 UTSW 16 58,746,748 (GRCm39) missense probably damaging 1.00
R0659:Or5k17 UTSW 16 58,746,772 (GRCm39) missense possibly damaging 0.94
R1433:Or5k17 UTSW 16 58,746,049 (GRCm39) missense probably benign
R1957:Or5k17 UTSW 16 58,746,530 (GRCm39) missense probably benign
R2155:Or5k17 UTSW 16 58,746,486 (GRCm39) missense probably benign 0.01
R2404:Or5k17 UTSW 16 58,745,998 (GRCm39) missense probably benign 0.01
R2568:Or5k17 UTSW 16 58,746,286 (GRCm39) missense probably benign 0.27
R4022:Or5k17 UTSW 16 58,746,483 (GRCm39) missense possibly damaging 0.94
R4592:Or5k17 UTSW 16 58,746,455 (GRCm39) missense probably benign 0.00
R4673:Or5k17 UTSW 16 58,746,053 (GRCm39) missense possibly damaging 0.61
R4880:Or5k17 UTSW 16 58,746,463 (GRCm39) missense probably damaging 0.98
R5109:Or5k17 UTSW 16 58,746,422 (GRCm39) missense probably benign 0.10
R5231:Or5k17 UTSW 16 58,746,077 (GRCm39) missense possibly damaging 0.94
R5291:Or5k17 UTSW 16 58,746,764 (GRCm39) missense possibly damaging 0.96
R5477:Or5k17 UTSW 16 58,746,393 (GRCm39) missense possibly damaging 0.61
R5524:Or5k17 UTSW 16 58,746,172 (GRCm39) missense probably benign 0.00
R5809:Or5k17 UTSW 16 58,746,860 (GRCm39) missense probably benign
R5830:Or5k17 UTSW 16 58,746,457 (GRCm39) missense possibly damaging 0.64
R6119:Or5k17 UTSW 16 58,746,895 (GRCm39) missense possibly damaging 0.94
R6217:Or5k17 UTSW 16 58,746,877 (GRCm39) missense probably benign 0.03
R6861:Or5k17 UTSW 16 58,746,867 (GRCm39) missense probably benign
R6939:Or5k17 UTSW 16 58,746,648 (GRCm39) nonsense probably null
R7376:Or5k17 UTSW 16 58,746,121 (GRCm39) missense possibly damaging 0.82
R7650:Or5k17 UTSW 16 58,746,416 (GRCm39) nonsense probably null
R8153:Or5k17 UTSW 16 58,746,149 (GRCm39) missense possibly damaging 0.47
R8947:Or5k17 UTSW 16 58,746,433 (GRCm39) missense probably benign
R9205:Or5k17 UTSW 16 58,746,486 (GRCm39) missense probably benign 0.01
R9205:Or5k17 UTSW 16 58,746,485 (GRCm39) missense probably benign 0.00
R9318:Or5k17 UTSW 16 58,746,271 (GRCm39) missense probably damaging 1.00
R9654:Or5k17 UTSW 16 58,746,752 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAATGCAGGTTACTGGC -3'
(R):5'- GAAGACACTTCTGTTCCTGCTG -3'

Sequencing Primer
(F):5'- ACTGGCTATGAATGTGCCTATACTC -3'
(R):5'- CATCTATCTGGTCACCATAGTGGG -3'
Posted On 2022-11-14