Mutagenetix > Incidental Mutation

Incidental Mutation 'R9763:Hecw2'

735795

Institutional Source

Beutler Lab

Gene Symbol

Hecw2

Ensembl Gene

ENSMUSG00000042807

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2

Synonyms

A730039N16Rik, Nedl2, D030049F17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R9763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53806876-54195168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53923915 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 812 (D812E)

Ref Sequence

ENSEMBL: ENSMUSP00000084942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]

AlphaFold

Q6I6G8

Predicted Effect

probably damaging
Transcript: ENSMUST00000087659
AA Change: D812E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: D812E

Domain	Start	End	E-Value	Type
Pfam:HECW_N	45	164	4.6e-62	PFAM
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120904
AA Change: D812E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: D812E

Domain	Start	End	E-Value	Type
PDB:2LFE\|A	42	162	6e-80	PDB
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,263,558	D2167E	possibly damaging	Het
Acadsb	T	A	7: 131,443,598	Y420N	probably benign	Het
Adcy1	T	A	11: 7,064,126	L176Q	probably damaging	Het
Amdhd1	T	A	10: 93,531,536	K252M	possibly damaging	Het
Aspa	C	A	11: 73,322,268	E83*	probably null	Het
Atat1	A	G	17: 35,910,007	L10P	probably damaging	Het
Ccdc141	T	A	2: 77,039,575	N862I	probably damaging	Het
Cdkal1	A	T	13: 29,625,709	C217*	probably null	Het
Cttnbp2	C	T	6: 18,435,241	S206N	probably benign	Het
Dner	A	T	1: 84,383,935	I651N	possibly damaging	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Ercc6l2	T	C	13: 63,834,624	V91A	probably damaging	Het
Fam198a	A	G	9: 121,976,355	D404G	probably damaging	Het
Gm11639	G	A	11: 104,999,659	G4189E	possibly damaging	Het
Gm13941	A	G	2: 111,101,173	L38S	unknown	Het
Golph3l	G	A	3: 95,609,774	E198K	possibly damaging	Het
Ikzf2	T	A	1: 69,548,676	E212V	possibly damaging	Het
Il6st	C	T	13: 112,490,517	S281F	probably damaging	Het
Kmt2d	CTGTTG	CTG	15: 98,845,176		probably benign	Het
Krt71	T	G	15: 101,738,322	K317T	probably damaging	Het
Lgi4	T	C	7: 31,060,595	F72S	probably damaging	Het
Map3k1	C	T	13: 111,775,965	R174H	probably damaging	Het
Marveld3	T	A	8: 109,961,743	H122L	probably benign	Het
Mrgprb2	A	G	7: 48,552,426	S184P	probably benign	Het
Mylk	G	T	16: 34,879,112	G282*	probably null	Het
Myo16	T	A	8: 10,400,528	M510K	unknown	Het
Naip5	C	G	13: 100,230,761	A276P	probably damaging	Het
Olfr1016	T	G	2: 85,799,716	N185H	possibly damaging	Het
Olfr1045	A	T	2: 86,197,837	M305K	probably benign	Het
Olfr1507	T	G	14: 52,490,850	Y38S	probably damaging	Het
Olfr411	T	C	11: 74,347,215	Y3C	probably damaging	Het
Olfr518	T	A	7: 108,881,667		probably benign	Het
Olfr519	T	G	7: 108,894,003	I140L	probably benign	Het
Pdzrn4	T	C	15: 92,770,495	Y843H	probably damaging	Het
Prkca	A	G	11: 108,013,041	V242A	possibly damaging	Het
Rbbp8	A	T	18: 11,732,204	M717L	probably benign	Het
Rnf150	T	C	8: 83,006,339	S272P	probably benign	Het
Rtraf	A	G	14: 19,816,246	V134A	probably damaging	Het
Rubcnl	T	A	14: 75,049,668	L592*	probably null	Het
Slc23a1	A	G	18: 35,622,311	S484P	probably damaging	Het
Slmap	A	G	14: 26,482,963	Y68H	probably damaging	Het
Speer4b	C	A	5: 27,500,208	V56L	probably damaging	Het
Sycp2l	T	A	13: 41,152,756	S84T		Het
Syne1	T	C	10: 5,057,858	D122G	probably benign	Het
Timd2	G	T	11: 46,682,713	P155T	probably benign	Het
Topbp1	G	A	9: 103,346,724	R1401Q	probably benign	Het
Trim36	C	A	18: 46,176,058	D312Y	probably benign	Het
Vps13c	A	G	9: 67,911,578	T1094A	probably benign	Het
Vwa8	T	A	14: 78,949,548	Y465N	probably damaging	Het
Zfpm1	T	C	8: 122,335,792	L530P	probably damaging	Het
Zmynd10	A	T	9: 107,548,766	T100S	probably benign	Het

Other mutations in Hecw2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Hecw2	APN	1	53830737	missense	probably damaging	1.00
IGL00338:Hecw2	APN	1	53827881	splice site	probably benign
IGL00530:Hecw2	APN	1	53853280	missense	probably damaging	1.00
IGL01343:Hecw2	APN	1	53826976	missense	probably damaging	0.96
IGL01503:Hecw2	APN	1	53826961	missense	probably damaging	1.00
IGL01989:Hecw2	APN	1	53840792	missense	probably damaging	1.00
IGL02016:Hecw2	APN	1	53831543	missense	possibly damaging	0.73
IGL02052:Hecw2	APN	1	53926511	missense	probably benign
IGL02085:Hecw2	APN	1	53942802	critical splice acceptor site	probably null
IGL02302:Hecw2	APN	1	53933248	missense	probably damaging	1.00
IGL02310:Hecw2	APN	1	53923916	missense	probably null	0.38
IGL02388:Hecw2	APN	1	53925699	missense	probably benign	0.17
IGL02499:Hecw2	APN	1	53926488	missense	probably benign
IGL02695:Hecw2	APN	1	53926209	missense	possibly damaging	0.94
IGL02732:Hecw2	APN	1	53926688	splice site	probably benign
IGL03100:Hecw2	APN	1	53831656	missense	probably damaging	1.00
IGL03175:Hecw2	APN	1	53926257	missense	possibly damaging	0.51
IGL03253:Hecw2	APN	1	53832716	missense	possibly damaging	0.85
IGL03356:Hecw2	APN	1	53927058	splice site	probably benign
Memoriam	UTSW	1	53926056	missense	probably benign
recollect	UTSW	1	53904422	missense	possibly damaging	0.88
ANU74:Hecw2	UTSW	1	53925694	missense	probably benign	0.01
R0077:Hecw2	UTSW	1	53868831	splice site	probably benign
R0133:Hecw2	UTSW	1	53830740	missense	probably damaging	1.00
R0268:Hecw2	UTSW	1	53926698	splice site	probably benign
R1303:Hecw2	UTSW	1	54040393	missense	probably benign	0.00
R1460:Hecw2	UTSW	1	53813245	missense	probably damaging	0.96
R1524:Hecw2	UTSW	1	53851618	missense	probably damaging	1.00
R1533:Hecw2	UTSW	1	53926545	splice site	probably null
R1828:Hecw2	UTSW	1	53926023	missense	probably benign
R2170:Hecw2	UTSW	1	53942797	missense	probably damaging	0.99
R2338:Hecw2	UTSW	1	53904422	missense	possibly damaging	0.88
R3016:Hecw2	UTSW	1	53830680	missense	probably damaging	1.00
R3872:Hecw2	UTSW	1	53832757	splice site	probably benign
R3892:Hecw2	UTSW	1	53926121	missense	probably benign	0.01
R4086:Hecw2	UTSW	1	53831656	missense	probably damaging	1.00
R4247:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4248:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4249:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4545:Hecw2	UTSW	1	53813222	makesense	probably null
R4805:Hecw2	UTSW	1	53840859	missense	probably damaging	1.00
R4834:Hecw2	UTSW	1	53830752	missense	probably damaging	1.00
R4884:Hecw2	UTSW	1	53950841	missense	probably benign	0.03
R4983:Hecw2	UTSW	1	53832671	missense	probably benign	0.42
R5168:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R5482:Hecw2	UTSW	1	53926201	missense	probably benign	0.09
R5549:Hecw2	UTSW	1	53925691	missense	possibly damaging	0.91
R5623:Hecw2	UTSW	1	53832623	missense	probably null	1.00
R5740:Hecw2	UTSW	1	53887603	missense	probably benign	0.12
R5919:Hecw2	UTSW	1	53937090	missense	probably damaging	0.99
R6058:Hecw2	UTSW	1	53923976	missense	possibly damaging	0.67
R6460:Hecw2	UTSW	1	53868833	splice site	probably null
R6875:Hecw2	UTSW	1	53937132	missense	probably benign	0.01
R7097:Hecw2	UTSW	1	53865124	missense	possibly damaging	0.88
R7131:Hecw2	UTSW	1	53865121	missense	probably damaging	1.00
R7291:Hecw2	UTSW	1	53914594	missense	probably damaging	1.00
R7401:Hecw2	UTSW	1	53904343	missense	probably damaging	1.00
R7482:Hecw2	UTSW	1	54040470	missense	probably damaging	0.99
R7501:Hecw2	UTSW	1	53913872	critical splice acceptor site	probably null
R7520:Hecw2	UTSW	1	53926056	missense	probably benign
R7611:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R8184:Hecw2	UTSW	1	54040387	missense	probably benign	0.37
R8286:Hecw2	UTSW	1	53840769	missense	probably damaging	1.00
R8300:Hecw2	UTSW	1	53887616	missense	probably null	0.07
R8354:Hecw2	UTSW	1	53925308	critical splice donor site	probably null
R8362:Hecw2	UTSW	1	54040491	start codon destroyed	probably null	0.51
R8691:Hecw2	UTSW	1	53865064	missense	probably benign	0.26
R8745:Hecw2	UTSW	1	53933171	missense	probably damaging	1.00
R8769:Hecw2	UTSW	1	53913348	missense	probably benign	0.00
R8830:Hecw2	UTSW	1	53891146	missense	probably damaging	1.00
R8842:Hecw2	UTSW	1	53950874	missense
R8874:Hecw2	UTSW	1	53904449	splice site	probably benign
R9064:Hecw2	UTSW	1	53826886	missense	probably benign	0.08
R9326:Hecw2	UTSW	1	54040210	missense	probably damaging	1.00
R9450:Hecw2	UTSW	1	53839029	nonsense	probably null
R9486:Hecw2	UTSW	1	53813307	missense	probably damaging	1.00
R9766:Hecw2	UTSW	1	53865128	missense	probably damaging	1.00
Z1177:Hecw2	UTSW	1	53923943	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTTCAGAACAGTACCAGAGGGG -3'
(R):5'- AGCAGCCTTGGAACTGATG -3'

Sequencing Primer
(F):5'- GAGTGCCTGGACAGAGCATCTC -3'
(R):5'- GTTCTCAAACCAATGGCC -3'

Posted On

2022-11-14