Incidental Mutation 'R9763:Dner'
ID 735798
Institutional Source Beutler Lab
Gene Symbol Dner
Ensembl Gene ENSMUSG00000036766
Gene Name delta/notch-like EGF repeat containing
Synonyms BET, A930026D19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 84347560-84673942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84361656 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 651 (I651N)
Ref Sequence ENSEMBL: ENSMUSP00000042927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049126]
AlphaFold Q8JZM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000049126
AA Change: I651N

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: I651N

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EGF 47 92 9.85e-5 SMART
EGF 97 133 2.33e-6 SMART
EGF 306 348 1.8e1 SMART
EGF 352 390 5e-6 SMART
EGF_CA 392 428 8.97e-8 SMART
EGF 433 466 3.54e-6 SMART
EGF 471 503 4.66e-6 SMART
EGF_CA 505 541 1.61e-9 SMART
EGF 546 579 9.7e-4 SMART
EGF_CA 581 617 4.52e-13 SMART
transmembrane domain 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,302,717 (GRCm39) D2167E possibly damaging Het
Acadsb T A 7: 131,045,327 (GRCm39) Y420N probably benign Het
Adcy1 T A 11: 7,014,126 (GRCm39) L176Q probably damaging Het
Amdhd1 T A 10: 93,367,398 (GRCm39) K252M possibly damaging Het
Aspa C A 11: 73,213,094 (GRCm39) E83* probably null Het
Atat1 A G 17: 36,220,899 (GRCm39) L10P probably damaging Het
Ccdc141 T A 2: 76,869,919 (GRCm39) N862I probably damaging Het
Cdkal1 A T 13: 29,809,692 (GRCm39) C217* probably null Het
Cttnbp2 C T 6: 18,435,240 (GRCm39) S206N probably benign Het
Efcab3 G A 11: 104,890,485 (GRCm39) G4189E possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Ercc6l2 T C 13: 63,982,438 (GRCm39) V91A probably damaging Het
Gask1a A G 9: 121,805,421 (GRCm39) D404G probably damaging Het
Gm13941 A G 2: 110,931,518 (GRCm39) L38S unknown Het
Golph3l G A 3: 95,517,085 (GRCm39) E198K possibly damaging Het
Hecw2 A C 1: 53,963,074 (GRCm39) D812E probably damaging Het
Ikzf2 T A 1: 69,587,835 (GRCm39) E212V possibly damaging Het
Il6st C T 13: 112,627,051 (GRCm39) S281F probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt71 T G 15: 101,646,757 (GRCm39) K317T probably damaging Het
Lgi4 T C 7: 30,760,020 (GRCm39) F72S probably damaging Het
Map3k1 C T 13: 111,912,499 (GRCm39) R174H probably damaging Het
Marveld3 T A 8: 110,688,375 (GRCm39) H122L probably benign Het
Mrgprb2 A G 7: 48,202,174 (GRCm39) S184P probably benign Het
Mylk G T 16: 34,699,482 (GRCm39) G282* probably null Het
Myo16 T A 8: 10,450,528 (GRCm39) M510K unknown Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Or10a3 T A 7: 108,480,874 (GRCm39) probably benign Het
Or10a3n T G 7: 108,493,210 (GRCm39) I140L probably benign Het
Or3a1d T C 11: 74,238,041 (GRCm39) Y3C probably damaging Het
Or4e5 T G 14: 52,728,307 (GRCm39) Y38S probably damaging Het
Or8j3 A T 2: 86,028,181 (GRCm39) M305K probably benign Het
Or9g20 T G 2: 85,630,060 (GRCm39) N185H possibly damaging Het
Pdzrn4 T C 15: 92,668,376 (GRCm39) Y843H probably damaging Het
Prkca A G 11: 107,903,867 (GRCm39) V242A possibly damaging Het
Rbbp8 A T 18: 11,865,261 (GRCm39) M717L probably benign Het
Rnf150 T C 8: 83,732,968 (GRCm39) S272P probably benign Het
Rtraf A G 14: 19,866,314 (GRCm39) V134A probably damaging Het
Rubcnl T A 14: 75,287,108 (GRCm39) L592* probably null Het
Slc23a1 A G 18: 35,755,364 (GRCm39) S484P probably damaging Het
Slmap A G 14: 26,204,118 (GRCm39) Y68H probably damaging Het
Speer4b C A 5: 27,705,206 (GRCm39) V56L probably damaging Het
Sycp2l T A 13: 41,306,232 (GRCm39) S84T Het
Syne1 T C 10: 5,007,858 (GRCm39) D122G probably benign Het
Timd2 G T 11: 46,573,540 (GRCm39) P155T probably benign Het
Topbp1 G A 9: 103,223,923 (GRCm39) R1401Q probably benign Het
Trim36 C A 18: 46,309,125 (GRCm39) D312Y probably benign Het
Vps13c A G 9: 67,818,860 (GRCm39) T1094A probably benign Het
Vwa8 T A 14: 79,186,988 (GRCm39) Y465N probably damaging Het
Zfpm1 T C 8: 123,062,531 (GRCm39) L530P probably damaging Het
Zmynd10 A T 9: 107,425,965 (GRCm39) T100S probably benign Het
Other mutations in Dner
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Dner APN 1 84,361,731 (GRCm39) missense probably benign 0.13
IGL02251:Dner APN 1 84,361,747 (GRCm39) missense probably damaging 1.00
IGL02904:Dner APN 1 84,512,665 (GRCm39) missense probably damaging 0.96
IGL03063:Dner APN 1 84,563,059 (GRCm39) missense possibly damaging 0.90
R0013:Dner UTSW 1 84,472,614 (GRCm39) splice site probably benign
R0112:Dner UTSW 1 84,560,774 (GRCm39) missense probably benign 0.06
R0196:Dner UTSW 1 84,348,553 (GRCm39) missense probably damaging 1.00
R0282:Dner UTSW 1 84,423,101 (GRCm39) splice site probably benign
R0282:Dner UTSW 1 84,383,686 (GRCm39) missense probably damaging 1.00
R0942:Dner UTSW 1 84,563,030 (GRCm39) splice site probably benign
R1143:Dner UTSW 1 84,423,185 (GRCm39) missense probably damaging 1.00
R1483:Dner UTSW 1 84,563,270 (GRCm39) utr 5 prime probably benign
R1585:Dner UTSW 1 84,563,177 (GRCm39) missense probably benign 0.05
R1636:Dner UTSW 1 84,563,051 (GRCm39) missense possibly damaging 0.89
R1739:Dner UTSW 1 84,348,505 (GRCm39) missense probably damaging 0.99
R1756:Dner UTSW 1 84,423,311 (GRCm39) missense probably damaging 0.98
R1960:Dner UTSW 1 84,423,177 (GRCm39) missense probably damaging 0.98
R2061:Dner UTSW 1 84,383,710 (GRCm39) missense probably damaging 1.00
R2157:Dner UTSW 1 84,361,659 (GRCm39) missense possibly damaging 0.88
R2265:Dner UTSW 1 84,563,270 (GRCm39) utr 5 prime probably benign
R2382:Dner UTSW 1 84,348,544 (GRCm39) missense probably damaging 1.00
R2507:Dner UTSW 1 84,560,801 (GRCm39) missense probably damaging 1.00
R3053:Dner UTSW 1 84,361,747 (GRCm39) missense probably damaging 1.00
R3917:Dner UTSW 1 84,563,270 (GRCm39) utr 5 prime probably benign
R4530:Dner UTSW 1 84,560,736 (GRCm39) missense probably damaging 1.00
R4552:Dner UTSW 1 84,361,578 (GRCm39) missense probably damaging 1.00
R4579:Dner UTSW 1 84,361,537 (GRCm39) missense probably damaging 0.97
R4593:Dner UTSW 1 84,673,449 (GRCm39) start codon destroyed probably null
R4711:Dner UTSW 1 84,361,618 (GRCm39) missense possibly damaging 0.75
R5102:Dner UTSW 1 84,383,691 (GRCm39) missense probably damaging 1.00
R5314:Dner UTSW 1 84,558,460 (GRCm39) missense probably damaging 1.00
R5370:Dner UTSW 1 84,563,270 (GRCm39) utr 5 prime probably benign
R6000:Dner UTSW 1 84,361,650 (GRCm39) missense possibly damaging 0.80
R6644:Dner UTSW 1 84,373,428 (GRCm39) missense probably damaging 1.00
R6764:Dner UTSW 1 84,472,502 (GRCm39) missense probably damaging 1.00
R6948:Dner UTSW 1 84,383,738 (GRCm39) missense probably damaging 1.00
R6991:Dner UTSW 1 84,454,123 (GRCm39) nonsense probably null
R7056:Dner UTSW 1 84,558,457 (GRCm39) missense possibly damaging 0.75
R7410:Dner UTSW 1 84,563,332 (GRCm39) missense probably damaging 1.00
R7490:Dner UTSW 1 84,563,270 (GRCm39) utr 5 prime probably benign
R7869:Dner UTSW 1 84,361,602 (GRCm39) missense probably benign 0.10
R7938:Dner UTSW 1 84,673,218 (GRCm39) missense possibly damaging 0.62
R8253:Dner UTSW 1 84,512,598 (GRCm39) missense probably damaging 1.00
R9016:Dner UTSW 1 84,673,226 (GRCm39) missense probably benign 0.05
R9170:Dner UTSW 1 84,512,647 (GRCm39) missense probably damaging 1.00
R9254:Dner UTSW 1 84,673,193 (GRCm39) missense probably benign 0.03
Z1176:Dner UTSW 1 84,361,701 (GRCm39) missense possibly damaging 0.88
Z1177:Dner UTSW 1 84,423,154 (GRCm39) missense probably damaging 0.99
Z1177:Dner UTSW 1 84,423,151 (GRCm39) missense probably damaging 1.00
Z1177:Dner UTSW 1 84,383,710 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTAGTGATAGCATCGCC -3'
(R):5'- CCCAGTTTAGATGACCCTTAGG -3'

Sequencing Primer
(F):5'- TAGTGATAGCATCGCCCTGGC -3'
(R):5'- CCCTTAGGTGAAGTTAGCGAC -3'
Posted On 2022-11-14