Incidental Mutation 'R9763:Ccdc141'
ID 735799
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Name coiled-coil domain containing 141
Synonyms ENSMUSG00000075261, CAMDI, 2610301F02Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 76840246-77000980 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76869919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 862 (N862I)
Ref Sequence ENSEMBL: ENSMUSP00000052945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000164114]
AlphaFold E9Q8Q6
Predicted Effect probably damaging
Transcript: ENSMUST00000049544
AA Change: N862I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033
AA Change: N862I

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164114
AA Change: N862I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033
AA Change: N862I

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,302,717 (GRCm39) D2167E possibly damaging Het
Acadsb T A 7: 131,045,327 (GRCm39) Y420N probably benign Het
Adcy1 T A 11: 7,014,126 (GRCm39) L176Q probably damaging Het
Amdhd1 T A 10: 93,367,398 (GRCm39) K252M possibly damaging Het
Aspa C A 11: 73,213,094 (GRCm39) E83* probably null Het
Atat1 A G 17: 36,220,899 (GRCm39) L10P probably damaging Het
Cdkal1 A T 13: 29,809,692 (GRCm39) C217* probably null Het
Cttnbp2 C T 6: 18,435,240 (GRCm39) S206N probably benign Het
Dner A T 1: 84,361,656 (GRCm39) I651N possibly damaging Het
Efcab3 G A 11: 104,890,485 (GRCm39) G4189E possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Ercc6l2 T C 13: 63,982,438 (GRCm39) V91A probably damaging Het
Gask1a A G 9: 121,805,421 (GRCm39) D404G probably damaging Het
Gm13941 A G 2: 110,931,518 (GRCm39) L38S unknown Het
Golph3l G A 3: 95,517,085 (GRCm39) E198K possibly damaging Het
Hecw2 A C 1: 53,963,074 (GRCm39) D812E probably damaging Het
Ikzf2 T A 1: 69,587,835 (GRCm39) E212V possibly damaging Het
Il6st C T 13: 112,627,051 (GRCm39) S281F probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt71 T G 15: 101,646,757 (GRCm39) K317T probably damaging Het
Lgi4 T C 7: 30,760,020 (GRCm39) F72S probably damaging Het
Map3k1 C T 13: 111,912,499 (GRCm39) R174H probably damaging Het
Marveld3 T A 8: 110,688,375 (GRCm39) H122L probably benign Het
Mrgprb2 A G 7: 48,202,174 (GRCm39) S184P probably benign Het
Mylk G T 16: 34,699,482 (GRCm39) G282* probably null Het
Myo16 T A 8: 10,450,528 (GRCm39) M510K unknown Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Or10a3 T A 7: 108,480,874 (GRCm39) probably benign Het
Or10a3n T G 7: 108,493,210 (GRCm39) I140L probably benign Het
Or3a1d T C 11: 74,238,041 (GRCm39) Y3C probably damaging Het
Or4e5 T G 14: 52,728,307 (GRCm39) Y38S probably damaging Het
Or8j3 A T 2: 86,028,181 (GRCm39) M305K probably benign Het
Or9g20 T G 2: 85,630,060 (GRCm39) N185H possibly damaging Het
Pdzrn4 T C 15: 92,668,376 (GRCm39) Y843H probably damaging Het
Prkca A G 11: 107,903,867 (GRCm39) V242A possibly damaging Het
Rbbp8 A T 18: 11,865,261 (GRCm39) M717L probably benign Het
Rnf150 T C 8: 83,732,968 (GRCm39) S272P probably benign Het
Rtraf A G 14: 19,866,314 (GRCm39) V134A probably damaging Het
Rubcnl T A 14: 75,287,108 (GRCm39) L592* probably null Het
Slc23a1 A G 18: 35,755,364 (GRCm39) S484P probably damaging Het
Slmap A G 14: 26,204,118 (GRCm39) Y68H probably damaging Het
Speer4b C A 5: 27,705,206 (GRCm39) V56L probably damaging Het
Sycp2l T A 13: 41,306,232 (GRCm39) S84T Het
Syne1 T C 10: 5,007,858 (GRCm39) D122G probably benign Het
Timd2 G T 11: 46,573,540 (GRCm39) P155T probably benign Het
Topbp1 G A 9: 103,223,923 (GRCm39) R1401Q probably benign Het
Trim36 C A 18: 46,309,125 (GRCm39) D312Y probably benign Het
Vps13c A G 9: 67,818,860 (GRCm39) T1094A probably benign Het
Vwa8 T A 14: 79,186,988 (GRCm39) Y465N probably damaging Het
Zfpm1 T C 8: 123,062,531 (GRCm39) L530P probably damaging Het
Zmynd10 A T 9: 107,425,965 (GRCm39) T100S probably benign Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 76,884,988 (GRCm39) missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 76,958,669 (GRCm39) missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 76,876,023 (GRCm39) missense probably benign 0.01
IGL01633:Ccdc141 APN 2 76,919,593 (GRCm39) missense probably benign 0.01
IGL01982:Ccdc141 APN 2 76,861,003 (GRCm39) missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 76,879,921 (GRCm39) critical splice donor site probably null
IGL02307:Ccdc141 APN 2 76,859,686 (GRCm39) missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 76,905,211 (GRCm39) nonsense probably null
IGL02737:Ccdc141 APN 2 76,888,268 (GRCm39) missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 76,884,953 (GRCm39) missense probably benign 0.05
IGL02949:Ccdc141 APN 2 76,857,938 (GRCm39) missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 76,859,579 (GRCm39) critical splice donor site probably null
Verloren UTSW 2 76,857,992 (GRCm39) missense probably damaging 1.00
Verschied UTSW 2 76,938,700 (GRCm39) splice site probably benign
R0153:Ccdc141 UTSW 2 76,995,582 (GRCm39) intron probably benign
R0384:Ccdc141 UTSW 2 76,857,992 (GRCm39) missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 76,869,794 (GRCm39) missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 76,869,837 (GRCm39) missense probably benign 0.00
R1332:Ccdc141 UTSW 2 76,844,784 (GRCm39) missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 76,844,784 (GRCm39) missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 76,860,945 (GRCm39) missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 76,845,140 (GRCm39) missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 76,885,027 (GRCm39) missense probably benign 0.41
R1726:Ccdc141 UTSW 2 76,938,700 (GRCm39) splice site probably benign
R1799:Ccdc141 UTSW 2 76,842,015 (GRCm39) missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 76,842,009 (GRCm39) missense probably benign 0.00
R1839:Ccdc141 UTSW 2 76,842,009 (GRCm39) missense probably benign 0.00
R1918:Ccdc141 UTSW 2 76,845,047 (GRCm39) missense probably benign 0.00
R2019:Ccdc141 UTSW 2 76,841,909 (GRCm39) missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 76,889,951 (GRCm39) missense probably benign 0.28
R2158:Ccdc141 UTSW 2 76,861,015 (GRCm39) missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 76,962,606 (GRCm39) missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77,000,746 (GRCm39) missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 76,905,342 (GRCm39) missense probably benign 0.11
R2382:Ccdc141 UTSW 2 76,841,886 (GRCm39) missense probably damaging 1.00
R3110:Ccdc141 UTSW 2 76,869,830 (GRCm39) missense probably benign 0.31
R3112:Ccdc141 UTSW 2 76,869,830 (GRCm39) missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77,000,776 (GRCm39) missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 76,962,641 (GRCm39) missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 76,962,641 (GRCm39) missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 76,890,024 (GRCm39) missense probably benign 0.02
R4748:Ccdc141 UTSW 2 76,888,324 (GRCm39) missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 76,876,099 (GRCm39) missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 76,954,680 (GRCm39) missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 76,905,260 (GRCm39) missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 76,998,907 (GRCm39) missense probably damaging 1.00
R5024:Ccdc141 UTSW 2 76,885,047 (GRCm39) missense probably benign 0.17
R5073:Ccdc141 UTSW 2 76,954,722 (GRCm39) splice site probably null
R5251:Ccdc141 UTSW 2 76,858,118 (GRCm39) missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 76,962,593 (GRCm39) missense probably benign 0.03
R5534:Ccdc141 UTSW 2 76,888,241 (GRCm39) missense probably benign
R5539:Ccdc141 UTSW 2 76,845,437 (GRCm39) missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 76,844,753 (GRCm39) missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 76,859,671 (GRCm39) missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 76,938,781 (GRCm39) missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 76,859,747 (GRCm39) missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 76,842,075 (GRCm39) missense probably benign 0.33
R6263:Ccdc141 UTSW 2 76,938,807 (GRCm39) missense probably damaging 1.00
R6502:Ccdc141 UTSW 2 77,000,745 (GRCm39) missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 76,842,099 (GRCm39) missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 76,859,579 (GRCm39) critical splice donor site probably null
R7014:Ccdc141 UTSW 2 76,962,641 (GRCm39) missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 76,871,797 (GRCm39) missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 76,879,927 (GRCm39) missense probably benign 0.39
R7300:Ccdc141 UTSW 2 76,845,038 (GRCm39) missense probably benign 0.00
R7654:Ccdc141 UTSW 2 76,872,822 (GRCm39) missense probably benign 0.05
R7834:Ccdc141 UTSW 2 76,889,889 (GRCm39) missense possibly damaging 0.81
R7868:Ccdc141 UTSW 2 76,938,756 (GRCm39) missense probably damaging 0.99
R7986:Ccdc141 UTSW 2 76,845,461 (GRCm39) missense probably benign 0.01
R8059:Ccdc141 UTSW 2 76,875,095 (GRCm39) missense probably damaging 1.00
R8082:Ccdc141 UTSW 2 76,954,588 (GRCm39) missense probably damaging 0.99
R8439:Ccdc141 UTSW 2 76,889,894 (GRCm39) missense possibly damaging 0.82
R8508:Ccdc141 UTSW 2 76,962,588 (GRCm39) missense probably benign 0.01
R8695:Ccdc141 UTSW 2 76,879,963 (GRCm39) missense probably benign 0.03
R8880:Ccdc141 UTSW 2 76,845,556 (GRCm39) missense probably benign 0.28
R8992:Ccdc141 UTSW 2 76,844,739 (GRCm39) missense probably damaging 1.00
R9048:Ccdc141 UTSW 2 76,853,872 (GRCm39) missense probably damaging 1.00
R9260:Ccdc141 UTSW 2 76,844,795 (GRCm39) missense probably damaging 1.00
R9297:Ccdc141 UTSW 2 76,842,028 (GRCm39) missense probably benign 0.34
R9418:Ccdc141 UTSW 2 76,871,766 (GRCm39) missense probably benign 0.05
R9601:Ccdc141 UTSW 2 76,885,073 (GRCm39) missense possibly damaging 0.64
R9628:Ccdc141 UTSW 2 76,844,838 (GRCm39) missense probably damaging 1.00
Z1088:Ccdc141 UTSW 2 76,958,616 (GRCm39) missense probably benign 0.03
Z1177:Ccdc141 UTSW 2 76,845,493 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGCTTTGGGCTCAGTG -3'
(R):5'- CTCTGAGGAGTTAGGCATGATG -3'

Sequencing Primer
(F):5'- AGTGTGCCCTTTCTCAAAGC -3'
(R):5'- CTATTCCATAATGTTGAGTGTCTGGC -3'
Posted On 2022-11-14