Incidental Mutation 'R9763:Zfpm1'
ID 735815
Institutional Source Beutler Lab
Gene Symbol Zfpm1
Ensembl Gene ENSMUSG00000049577
Gene Name zinc finger protein, multitype 1
Synonyms Fog1, Friend of GATA-1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.797) question?
Stock # R9763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 123008880-123063990 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123062531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 530 (L530P)
Ref Sequence ENSEMBL: ENSMUSP00000058037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]
AlphaFold O35615
PDB Structure Solution structure of the third zinc finger domain of FOG-1 [SOLUTION NMR]
Solution structure of the PR domain of FOG-1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000054052
AA Change: L530P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: L530P

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
ZnF_C2H2 255 275 3.13e1 SMART
ZnF_C2H2 303 327 1.69e-3 SMART
ZnF_C2H2 333 355 1.53e-1 SMART
ZnF_C2H2 361 384 9.46e0 SMART
low complexity region 508 525 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
ZnF_C2H2 590 610 1.41e2 SMART
low complexity region 626 643 N/A INTRINSIC
low complexity region 644 663 N/A INTRINSIC
ZnF_C2H2 696 723 1.78e2 SMART
low complexity region 725 755 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
low complexity region 785 806 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ZnF_C2H2 836 856 7.77e1 SMART
ZnF_C2H2 868 891 1.96e1 SMART
low complexity region 948 961 N/A INTRINSIC
ZnF_C2H2 963 989 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,302,717 (GRCm39) D2167E possibly damaging Het
Acadsb T A 7: 131,045,327 (GRCm39) Y420N probably benign Het
Adcy1 T A 11: 7,014,126 (GRCm39) L176Q probably damaging Het
Amdhd1 T A 10: 93,367,398 (GRCm39) K252M possibly damaging Het
Aspa C A 11: 73,213,094 (GRCm39) E83* probably null Het
Atat1 A G 17: 36,220,899 (GRCm39) L10P probably damaging Het
Ccdc141 T A 2: 76,869,919 (GRCm39) N862I probably damaging Het
Cdkal1 A T 13: 29,809,692 (GRCm39) C217* probably null Het
Cttnbp2 C T 6: 18,435,240 (GRCm39) S206N probably benign Het
Dner A T 1: 84,361,656 (GRCm39) I651N possibly damaging Het
Efcab3 G A 11: 104,890,485 (GRCm39) G4189E possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Ercc6l2 T C 13: 63,982,438 (GRCm39) V91A probably damaging Het
Gask1a A G 9: 121,805,421 (GRCm39) D404G probably damaging Het
Gm13941 A G 2: 110,931,518 (GRCm39) L38S unknown Het
Golph3l G A 3: 95,517,085 (GRCm39) E198K possibly damaging Het
Hecw2 A C 1: 53,963,074 (GRCm39) D812E probably damaging Het
Ikzf2 T A 1: 69,587,835 (GRCm39) E212V possibly damaging Het
Il6st C T 13: 112,627,051 (GRCm39) S281F probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt71 T G 15: 101,646,757 (GRCm39) K317T probably damaging Het
Lgi4 T C 7: 30,760,020 (GRCm39) F72S probably damaging Het
Map3k1 C T 13: 111,912,499 (GRCm39) R174H probably damaging Het
Marveld3 T A 8: 110,688,375 (GRCm39) H122L probably benign Het
Mrgprb2 A G 7: 48,202,174 (GRCm39) S184P probably benign Het
Mylk G T 16: 34,699,482 (GRCm39) G282* probably null Het
Myo16 T A 8: 10,450,528 (GRCm39) M510K unknown Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Or10a3 T A 7: 108,480,874 (GRCm39) probably benign Het
Or10a3n T G 7: 108,493,210 (GRCm39) I140L probably benign Het
Or3a1d T C 11: 74,238,041 (GRCm39) Y3C probably damaging Het
Or4e5 T G 14: 52,728,307 (GRCm39) Y38S probably damaging Het
Or8j3 A T 2: 86,028,181 (GRCm39) M305K probably benign Het
Or9g20 T G 2: 85,630,060 (GRCm39) N185H possibly damaging Het
Pdzrn4 T C 15: 92,668,376 (GRCm39) Y843H probably damaging Het
Prkca A G 11: 107,903,867 (GRCm39) V242A possibly damaging Het
Rbbp8 A T 18: 11,865,261 (GRCm39) M717L probably benign Het
Rnf150 T C 8: 83,732,968 (GRCm39) S272P probably benign Het
Rtraf A G 14: 19,866,314 (GRCm39) V134A probably damaging Het
Rubcnl T A 14: 75,287,108 (GRCm39) L592* probably null Het
Slc23a1 A G 18: 35,755,364 (GRCm39) S484P probably damaging Het
Slmap A G 14: 26,204,118 (GRCm39) Y68H probably damaging Het
Speer4b C A 5: 27,705,206 (GRCm39) V56L probably damaging Het
Sycp2l T A 13: 41,306,232 (GRCm39) S84T Het
Syne1 T C 10: 5,007,858 (GRCm39) D122G probably benign Het
Timd2 G T 11: 46,573,540 (GRCm39) P155T probably benign Het
Topbp1 G A 9: 103,223,923 (GRCm39) R1401Q probably benign Het
Trim36 C A 18: 46,309,125 (GRCm39) D312Y probably benign Het
Vps13c A G 9: 67,818,860 (GRCm39) T1094A probably benign Het
Vwa8 T A 14: 79,186,988 (GRCm39) Y465N probably damaging Het
Zmynd10 A T 9: 107,425,965 (GRCm39) T100S probably benign Het
Other mutations in Zfpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Zfpm1 APN 8 123,058,859 (GRCm39) missense possibly damaging 0.65
R0006:Zfpm1 UTSW 8 123,061,227 (GRCm39) missense probably damaging 1.00
R0508:Zfpm1 UTSW 8 123,061,872 (GRCm39) missense probably damaging 1.00
R0631:Zfpm1 UTSW 8 123,063,613 (GRCm39) intron probably benign
R0729:Zfpm1 UTSW 8 123,063,398 (GRCm39) missense probably benign 0.20
R0883:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1509:Zfpm1 UTSW 8 123,034,285 (GRCm39) missense possibly damaging 0.63
R1938:Zfpm1 UTSW 8 123,061,663 (GRCm39) splice site probably null
R2060:Zfpm1 UTSW 8 123,063,331 (GRCm39) missense probably benign 0.37
R3735:Zfpm1 UTSW 8 123,050,475 (GRCm39) missense possibly damaging 0.83
R3736:Zfpm1 UTSW 8 123,050,475 (GRCm39) missense possibly damaging 0.83
R4528:Zfpm1 UTSW 8 123,062,381 (GRCm39) missense probably benign 0.06
R4735:Zfpm1 UTSW 8 123,062,219 (GRCm39) missense probably benign 0.24
R4924:Zfpm1 UTSW 8 123,061,347 (GRCm39) missense possibly damaging 0.95
R5347:Zfpm1 UTSW 8 123,062,269 (GRCm39) missense possibly damaging 0.94
R5375:Zfpm1 UTSW 8 123,062,812 (GRCm39) missense probably benign 0.00
R5470:Zfpm1 UTSW 8 123,060,532 (GRCm39) missense probably damaging 0.99
R6358:Zfpm1 UTSW 8 123,063,850 (GRCm39) intron probably benign
R6768:Zfpm1 UTSW 8 123,061,195 (GRCm39) missense probably damaging 1.00
R6966:Zfpm1 UTSW 8 123,058,904 (GRCm39) missense probably damaging 1.00
R7422:Zfpm1 UTSW 8 123,063,698 (GRCm39) missense unknown
R7782:Zfpm1 UTSW 8 123,063,689 (GRCm39) missense unknown
R8065:Zfpm1 UTSW 8 123,062,323 (GRCm39) missense probably benign 0.00
R8067:Zfpm1 UTSW 8 123,062,323 (GRCm39) missense probably benign 0.00
R8192:Zfpm1 UTSW 8 123,058,833 (GRCm39) missense probably damaging 1.00
R8835:Zfpm1 UTSW 8 123,063,772 (GRCm39) missense unknown
R9308:Zfpm1 UTSW 8 123,034,231 (GRCm39) missense probably benign 0.13
R9342:Zfpm1 UTSW 8 123,061,308 (GRCm39) missense probably benign 0.29
R9698:Zfpm1 UTSW 8 123,063,868 (GRCm39) missense unknown
Z1192:Zfpm1 UTSW 8 123,060,612 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGGCCGAAGTCACCAAC -3'
(R):5'- ATCTCGCACTCAAAGCACGTG -3'

Sequencing Primer
(F):5'- CATCAAGGTGGAGGCTGC -3'
(R):5'- ACGTGGCACCCTTAGTCC -3'
Posted On 2022-11-14