Incidental Mutation 'R9763:Zmynd10'
ID 735818
Institutional Source Beutler Lab
Gene Symbol Zmynd10
Ensembl Gene ENSMUSG00000010044
Gene Name zinc finger, MYND domain containing 10
Synonyms Blu
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.725) question?
Stock # R9763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107424497-107428518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107425965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 100 (T100S)
Ref Sequence ENSEMBL: ENSMUSP00000010188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010188] [ENSMUST00000010201] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198] [ENSMUST00000193303] [ENSMUST00000195370]
AlphaFold Q99ML0
Predicted Effect probably benign
Transcript: ENSMUST00000010188
AA Change: T100S

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010188
Gene: ENSMUSG00000010044
AA Change: T100S

DomainStartEndE-ValueType
Pfam:zf-MYND 394 430 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010201
SMART Domains Protein: ENSMUSP00000010201
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 5 279 1.7e-75 PFAM
Pfam:NPR2 269 373 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093786
SMART Domains Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
C1 44 101 4.7e-7 SMART
low complexity region 168 185 N/A INTRINSIC
RA 194 288 6.26e-24 SMART
PDB:4LGD|H 289 334 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000122225
SMART Domains Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
C1 44 105 1.92e-3 SMART
low complexity region 172 189 N/A INTRINSIC
RA 198 292 6.26e-24 SMART
Pfam:Nore1-SARAH 299 338 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156198
SMART Domains Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
Blast:C1 44 83 6e-24 BLAST
SCOP:d1ptq__ 52 82 5e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193303
Predicted Effect probably benign
Transcript: ENSMUST00000195370
SMART Domains Protein: ENSMUSP00000141746
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 2 156 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a MYND-type zinc finger domain that likely functions in assembly of the dynein motor. Mutations in this gene can cause primary ciliary dyskinesia. This gene is also considered a tumor suppressor gene and is often mutated, deleted, or hypermethylated and silenced in cancer cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,302,717 (GRCm39) D2167E possibly damaging Het
Acadsb T A 7: 131,045,327 (GRCm39) Y420N probably benign Het
Adcy1 T A 11: 7,014,126 (GRCm39) L176Q probably damaging Het
Amdhd1 T A 10: 93,367,398 (GRCm39) K252M possibly damaging Het
Aspa C A 11: 73,213,094 (GRCm39) E83* probably null Het
Atat1 A G 17: 36,220,899 (GRCm39) L10P probably damaging Het
Ccdc141 T A 2: 76,869,919 (GRCm39) N862I probably damaging Het
Cdkal1 A T 13: 29,809,692 (GRCm39) C217* probably null Het
Cttnbp2 C T 6: 18,435,240 (GRCm39) S206N probably benign Het
Dner A T 1: 84,361,656 (GRCm39) I651N possibly damaging Het
Efcab3 G A 11: 104,890,485 (GRCm39) G4189E possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Ercc6l2 T C 13: 63,982,438 (GRCm39) V91A probably damaging Het
Gask1a A G 9: 121,805,421 (GRCm39) D404G probably damaging Het
Gm13941 A G 2: 110,931,518 (GRCm39) L38S unknown Het
Golph3l G A 3: 95,517,085 (GRCm39) E198K possibly damaging Het
Hecw2 A C 1: 53,963,074 (GRCm39) D812E probably damaging Het
Ikzf2 T A 1: 69,587,835 (GRCm39) E212V possibly damaging Het
Il6st C T 13: 112,627,051 (GRCm39) S281F probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt71 T G 15: 101,646,757 (GRCm39) K317T probably damaging Het
Lgi4 T C 7: 30,760,020 (GRCm39) F72S probably damaging Het
Map3k1 C T 13: 111,912,499 (GRCm39) R174H probably damaging Het
Marveld3 T A 8: 110,688,375 (GRCm39) H122L probably benign Het
Mrgprb2 A G 7: 48,202,174 (GRCm39) S184P probably benign Het
Mylk G T 16: 34,699,482 (GRCm39) G282* probably null Het
Myo16 T A 8: 10,450,528 (GRCm39) M510K unknown Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Or10a3 T A 7: 108,480,874 (GRCm39) probably benign Het
Or10a3n T G 7: 108,493,210 (GRCm39) I140L probably benign Het
Or3a1d T C 11: 74,238,041 (GRCm39) Y3C probably damaging Het
Or4e5 T G 14: 52,728,307 (GRCm39) Y38S probably damaging Het
Or8j3 A T 2: 86,028,181 (GRCm39) M305K probably benign Het
Or9g20 T G 2: 85,630,060 (GRCm39) N185H possibly damaging Het
Pdzrn4 T C 15: 92,668,376 (GRCm39) Y843H probably damaging Het
Prkca A G 11: 107,903,867 (GRCm39) V242A possibly damaging Het
Rbbp8 A T 18: 11,865,261 (GRCm39) M717L probably benign Het
Rnf150 T C 8: 83,732,968 (GRCm39) S272P probably benign Het
Rtraf A G 14: 19,866,314 (GRCm39) V134A probably damaging Het
Rubcnl T A 14: 75,287,108 (GRCm39) L592* probably null Het
Slc23a1 A G 18: 35,755,364 (GRCm39) S484P probably damaging Het
Slmap A G 14: 26,204,118 (GRCm39) Y68H probably damaging Het
Speer4b C A 5: 27,705,206 (GRCm39) V56L probably damaging Het
Sycp2l T A 13: 41,306,232 (GRCm39) S84T Het
Syne1 T C 10: 5,007,858 (GRCm39) D122G probably benign Het
Timd2 G T 11: 46,573,540 (GRCm39) P155T probably benign Het
Topbp1 G A 9: 103,223,923 (GRCm39) R1401Q probably benign Het
Trim36 C A 18: 46,309,125 (GRCm39) D312Y probably benign Het
Vps13c A G 9: 67,818,860 (GRCm39) T1094A probably benign Het
Vwa8 T A 14: 79,186,988 (GRCm39) Y465N probably damaging Het
Zfpm1 T C 8: 123,062,531 (GRCm39) L530P probably damaging Het
Other mutations in Zmynd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Zmynd10 APN 9 107,427,731 (GRCm39) missense probably damaging 0.96
R0152:Zmynd10 UTSW 9 107,428,144 (GRCm39) splice site probably null
R0749:Zmynd10 UTSW 9 107,425,882 (GRCm39) missense probably damaging 0.96
R1899:Zmynd10 UTSW 9 107,427,236 (GRCm39) missense probably benign 0.20
R1900:Zmynd10 UTSW 9 107,427,236 (GRCm39) missense probably benign 0.20
R4111:Zmynd10 UTSW 9 107,426,251 (GRCm39) nonsense probably null
R5403:Zmynd10 UTSW 9 107,427,785 (GRCm39) missense possibly damaging 0.59
R5468:Zmynd10 UTSW 9 107,427,536 (GRCm39) missense probably benign 0.00
R6430:Zmynd10 UTSW 9 107,425,911 (GRCm39) nonsense probably null
R6743:Zmynd10 UTSW 9 107,425,079 (GRCm39) missense possibly damaging 0.94
R7117:Zmynd10 UTSW 9 107,424,716 (GRCm39) missense probably benign 0.22
R7247:Zmynd10 UTSW 9 107,425,976 (GRCm39) missense possibly damaging 0.95
R7291:Zmynd10 UTSW 9 107,426,503 (GRCm39) missense probably benign 0.00
R8263:Zmynd10 UTSW 9 107,426,516 (GRCm39) missense possibly damaging 0.84
R9128:Zmynd10 UTSW 9 107,426,326 (GRCm39) missense
R9302:Zmynd10 UTSW 9 107,426,516 (GRCm39) missense possibly damaging 0.84
R9358:Zmynd10 UTSW 9 107,426,249 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGGCCATTCAGAGGAAACC -3'
(R):5'- CAGAGTAGTGTCTCACCTTGTGG -3'

Sequencing Primer
(F):5'- CTTAAGACAGGCTAAAGCTGGGAC -3'
(R):5'- GTCTCACCTTGTGGAAGAACACTG -3'
Posted On 2022-11-14