Incidental Mutation 'R9763:Ercc6l2'
ID 735830
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms 0610007P08Rik, 9330134C04Rik, 1700019D06Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.278) question?
Stock # R9763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 63963054-64048116 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63982438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000021926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021925] [ENSMUST00000021926] [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000142827] [ENSMUST00000144763] [ENSMUST00000159957]
AlphaFold Q9JIM3
Predicted Effect
SMART Domains Protein: ENSMUSP00000021925
Gene: ENSMUSG00000021470
AA Change: V206A

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 2e-13 BLAST
HELICc 512 589 6.96e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021926
AA Change: V91A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021926
Gene: ENSMUSG00000021470
AA Change: V91A

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
DEXDc 28 216 1.74e-12 SMART
Blast:DEXDc 265 310 1e-13 BLAST
Blast:DEXDc 317 450 4e-30 BLAST
SCOP:d1hv8a2 388 466 7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067821
AA Change: V206A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470
AA Change: V206A

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142827
AA Change: V84A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115796
Gene: ENSMUSG00000021470
AA Change: V84A

DomainStartEndE-ValueType
Pfam:DEAD 1 144 5.4e-6 PFAM
Pfam:SNF2_N 3 144 1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144763
AA Change: V206A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:SNF2_N 101 195 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,302,717 (GRCm39) D2167E possibly damaging Het
Acadsb T A 7: 131,045,327 (GRCm39) Y420N probably benign Het
Adcy1 T A 11: 7,014,126 (GRCm39) L176Q probably damaging Het
Amdhd1 T A 10: 93,367,398 (GRCm39) K252M possibly damaging Het
Aspa C A 11: 73,213,094 (GRCm39) E83* probably null Het
Atat1 A G 17: 36,220,899 (GRCm39) L10P probably damaging Het
Ccdc141 T A 2: 76,869,919 (GRCm39) N862I probably damaging Het
Cdkal1 A T 13: 29,809,692 (GRCm39) C217* probably null Het
Cttnbp2 C T 6: 18,435,240 (GRCm39) S206N probably benign Het
Dner A T 1: 84,361,656 (GRCm39) I651N possibly damaging Het
Efcab3 G A 11: 104,890,485 (GRCm39) G4189E possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Gask1a A G 9: 121,805,421 (GRCm39) D404G probably damaging Het
Gm13941 A G 2: 110,931,518 (GRCm39) L38S unknown Het
Golph3l G A 3: 95,517,085 (GRCm39) E198K possibly damaging Het
Hecw2 A C 1: 53,963,074 (GRCm39) D812E probably damaging Het
Ikzf2 T A 1: 69,587,835 (GRCm39) E212V possibly damaging Het
Il6st C T 13: 112,627,051 (GRCm39) S281F probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt71 T G 15: 101,646,757 (GRCm39) K317T probably damaging Het
Lgi4 T C 7: 30,760,020 (GRCm39) F72S probably damaging Het
Map3k1 C T 13: 111,912,499 (GRCm39) R174H probably damaging Het
Marveld3 T A 8: 110,688,375 (GRCm39) H122L probably benign Het
Mrgprb2 A G 7: 48,202,174 (GRCm39) S184P probably benign Het
Mylk G T 16: 34,699,482 (GRCm39) G282* probably null Het
Myo16 T A 8: 10,450,528 (GRCm39) M510K unknown Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Or10a3 T A 7: 108,480,874 (GRCm39) probably benign Het
Or10a3n T G 7: 108,493,210 (GRCm39) I140L probably benign Het
Or3a1d T C 11: 74,238,041 (GRCm39) Y3C probably damaging Het
Or4e5 T G 14: 52,728,307 (GRCm39) Y38S probably damaging Het
Or8j3 A T 2: 86,028,181 (GRCm39) M305K probably benign Het
Or9g20 T G 2: 85,630,060 (GRCm39) N185H possibly damaging Het
Pdzrn4 T C 15: 92,668,376 (GRCm39) Y843H probably damaging Het
Prkca A G 11: 107,903,867 (GRCm39) V242A possibly damaging Het
Rbbp8 A T 18: 11,865,261 (GRCm39) M717L probably benign Het
Rnf150 T C 8: 83,732,968 (GRCm39) S272P probably benign Het
Rtraf A G 14: 19,866,314 (GRCm39) V134A probably damaging Het
Rubcnl T A 14: 75,287,108 (GRCm39) L592* probably null Het
Slc23a1 A G 18: 35,755,364 (GRCm39) S484P probably damaging Het
Slmap A G 14: 26,204,118 (GRCm39) Y68H probably damaging Het
Speer4b C A 5: 27,705,206 (GRCm39) V56L probably damaging Het
Sycp2l T A 13: 41,306,232 (GRCm39) S84T Het
Syne1 T C 10: 5,007,858 (GRCm39) D122G probably benign Het
Timd2 G T 11: 46,573,540 (GRCm39) P155T probably benign Het
Topbp1 G A 9: 103,223,923 (GRCm39) R1401Q probably benign Het
Trim36 C A 18: 46,309,125 (GRCm39) D312Y probably benign Het
Vps13c A G 9: 67,818,860 (GRCm39) T1094A probably benign Het
Vwa8 T A 14: 79,186,988 (GRCm39) Y465N probably damaging Het
Zfpm1 T C 8: 123,062,531 (GRCm39) L530P probably damaging Het
Zmynd10 A T 9: 107,425,965 (GRCm39) T100S probably benign Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 64,006,133 (GRCm39) missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63,992,427 (GRCm39) missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63,996,586 (GRCm39) missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63,995,268 (GRCm39) missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63,967,566 (GRCm39) nonsense probably null
IGL02175:Ercc6l2 APN 13 64,017,004 (GRCm39) utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 64,000,783 (GRCm39) missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 64,001,497 (GRCm39) missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 64,001,497 (GRCm39) missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 64,001,437 (GRCm39) splice site probably null
PIT4812001:Ercc6l2 UTSW 13 64,006,071 (GRCm39) missense possibly damaging 0.58
R0142:Ercc6l2 UTSW 13 64,020,320 (GRCm39) unclassified probably benign
R0648:Ercc6l2 UTSW 13 63,992,459 (GRCm39) missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 64,016,934 (GRCm39) missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63,972,685 (GRCm39) missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 64,020,272 (GRCm39) unclassified probably benign
R2108:Ercc6l2 UTSW 13 64,019,802 (GRCm39) unclassified probably benign
R2111:Ercc6l2 UTSW 13 63,982,563 (GRCm39) missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63,996,585 (GRCm39) missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 64,013,821 (GRCm39) missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63,992,409 (GRCm39) missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63,989,264 (GRCm39) missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 64,018,549 (GRCm39) unclassified probably benign
R4233:Ercc6l2 UTSW 13 64,019,982 (GRCm39) unclassified probably benign
R4782:Ercc6l2 UTSW 13 63,982,552 (GRCm39) missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 64,042,627 (GRCm39) utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 64,046,845 (GRCm39) utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 64,016,925 (GRCm39) missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 64,020,072 (GRCm39) unclassified probably benign
R6128:Ercc6l2 UTSW 13 64,001,563 (GRCm39) missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 64,020,158 (GRCm39) unclassified probably benign
R7238:Ercc6l2 UTSW 13 64,013,798 (GRCm39) missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63,967,589 (GRCm39) missense probably damaging 0.96
R7708:Ercc6l2 UTSW 13 63,989,328 (GRCm39) nonsense probably null
R8085:Ercc6l2 UTSW 13 63,992,367 (GRCm39) missense probably benign 0.00
R8131:Ercc6l2 UTSW 13 63,982,561 (GRCm39) missense probably damaging 1.00
R8259:Ercc6l2 UTSW 13 64,020,285 (GRCm39) missense
R8372:Ercc6l2 UTSW 13 64,001,563 (GRCm39) missense probably damaging 0.98
R8479:Ercc6l2 UTSW 13 63,972,629 (GRCm39) missense possibly damaging 0.95
R9034:Ercc6l2 UTSW 13 63,992,447 (GRCm39) missense probably damaging 0.97
R9065:Ercc6l2 UTSW 13 63,967,866 (GRCm39) missense possibly damaging 0.93
R9557:Ercc6l2 UTSW 13 63,989,936 (GRCm39) missense probably damaging 1.00
R9700:Ercc6l2 UTSW 13 63,967,525 (GRCm39) missense probably benign 0.32
RF013:Ercc6l2 UTSW 13 64,000,831 (GRCm39) missense probably benign 0.06
Z1088:Ercc6l2 UTSW 13 64,001,542 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGCCCACATTTAGCAAACC -3'
(R):5'- GAGCCACGATATAAAGATGCACATG -3'

Sequencing Primer
(F):5'- CCCACATTTAGCAAACCAATTAGTTG -3'
(R):5'- ATGCACATGACCGATGTCG -3'
Posted On 2022-11-14