Incidental Mutation 'R9763:Map3k1'
ID 735832
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Name mitogen-activated protein kinase kinase kinase 1
Synonyms MEKK1, Mekk
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.909) question?
Stock # R9763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 111882962-111945527 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 111912499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 174 (R174H)
Ref Sequence ENSEMBL: ENSMUSP00000104890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267] [ENSMUST00000145055]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109267
AA Change: R174H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: R174H

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145055
AA Change: R16H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117863
Gene: ENSMUSG00000021754
AA Change: R16H

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
Pfam:SWIM 175 203 2.2e-8 PFAM
low complexity region 259 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,302,717 (GRCm39) D2167E possibly damaging Het
Acadsb T A 7: 131,045,327 (GRCm39) Y420N probably benign Het
Adcy1 T A 11: 7,014,126 (GRCm39) L176Q probably damaging Het
Amdhd1 T A 10: 93,367,398 (GRCm39) K252M possibly damaging Het
Aspa C A 11: 73,213,094 (GRCm39) E83* probably null Het
Atat1 A G 17: 36,220,899 (GRCm39) L10P probably damaging Het
Ccdc141 T A 2: 76,869,919 (GRCm39) N862I probably damaging Het
Cdkal1 A T 13: 29,809,692 (GRCm39) C217* probably null Het
Cttnbp2 C T 6: 18,435,240 (GRCm39) S206N probably benign Het
Dner A T 1: 84,361,656 (GRCm39) I651N possibly damaging Het
Efcab3 G A 11: 104,890,485 (GRCm39) G4189E possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Ercc6l2 T C 13: 63,982,438 (GRCm39) V91A probably damaging Het
Gask1a A G 9: 121,805,421 (GRCm39) D404G probably damaging Het
Gm13941 A G 2: 110,931,518 (GRCm39) L38S unknown Het
Golph3l G A 3: 95,517,085 (GRCm39) E198K possibly damaging Het
Hecw2 A C 1: 53,963,074 (GRCm39) D812E probably damaging Het
Ikzf2 T A 1: 69,587,835 (GRCm39) E212V possibly damaging Het
Il6st C T 13: 112,627,051 (GRCm39) S281F probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt71 T G 15: 101,646,757 (GRCm39) K317T probably damaging Het
Lgi4 T C 7: 30,760,020 (GRCm39) F72S probably damaging Het
Marveld3 T A 8: 110,688,375 (GRCm39) H122L probably benign Het
Mrgprb2 A G 7: 48,202,174 (GRCm39) S184P probably benign Het
Mylk G T 16: 34,699,482 (GRCm39) G282* probably null Het
Myo16 T A 8: 10,450,528 (GRCm39) M510K unknown Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Or10a3 T A 7: 108,480,874 (GRCm39) probably benign Het
Or10a3n T G 7: 108,493,210 (GRCm39) I140L probably benign Het
Or3a1d T C 11: 74,238,041 (GRCm39) Y3C probably damaging Het
Or4e5 T G 14: 52,728,307 (GRCm39) Y38S probably damaging Het
Or8j3 A T 2: 86,028,181 (GRCm39) M305K probably benign Het
Or9g20 T G 2: 85,630,060 (GRCm39) N185H possibly damaging Het
Pdzrn4 T C 15: 92,668,376 (GRCm39) Y843H probably damaging Het
Prkca A G 11: 107,903,867 (GRCm39) V242A possibly damaging Het
Rbbp8 A T 18: 11,865,261 (GRCm39) M717L probably benign Het
Rnf150 T C 8: 83,732,968 (GRCm39) S272P probably benign Het
Rtraf A G 14: 19,866,314 (GRCm39) V134A probably damaging Het
Rubcnl T A 14: 75,287,108 (GRCm39) L592* probably null Het
Slc23a1 A G 18: 35,755,364 (GRCm39) S484P probably damaging Het
Slmap A G 14: 26,204,118 (GRCm39) Y68H probably damaging Het
Speer4b C A 5: 27,705,206 (GRCm39) V56L probably damaging Het
Sycp2l T A 13: 41,306,232 (GRCm39) S84T Het
Syne1 T C 10: 5,007,858 (GRCm39) D122G probably benign Het
Timd2 G T 11: 46,573,540 (GRCm39) P155T probably benign Het
Topbp1 G A 9: 103,223,923 (GRCm39) R1401Q probably benign Het
Trim36 C A 18: 46,309,125 (GRCm39) D312Y probably benign Het
Vps13c A G 9: 67,818,860 (GRCm39) T1094A probably benign Het
Vwa8 T A 14: 79,186,988 (GRCm39) Y465N probably damaging Het
Zfpm1 T C 8: 123,062,531 (GRCm39) L530P probably damaging Het
Zmynd10 A T 9: 107,425,965 (GRCm39) T100S probably benign Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111,894,723 (GRCm39) critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111,891,196 (GRCm39) missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111,892,777 (GRCm39) missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111,892,059 (GRCm39) missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111,885,559 (GRCm39) missense probably benign 0.01
IGL03213:Map3k1 APN 13 111,885,426 (GRCm39) utr 3 prime probably benign
Nepal UTSW 13 111,888,983 (GRCm39) missense probably benign 0.07
Snow_leopard UTSW 13 111,892,298 (GRCm39) nonsense probably null
R0005:Map3k1 UTSW 13 111,892,238 (GRCm39) missense probably benign 0.00
R0025:Map3k1 UTSW 13 111,892,663 (GRCm39) missense probably benign
R0506:Map3k1 UTSW 13 111,892,298 (GRCm39) nonsense probably null
R0540:Map3k1 UTSW 13 111,900,044 (GRCm39) missense probably benign 0.05
R0607:Map3k1 UTSW 13 111,900,044 (GRCm39) missense probably benign 0.05
R0898:Map3k1 UTSW 13 111,904,490 (GRCm39) unclassified probably benign
R1171:Map3k1 UTSW 13 111,892,177 (GRCm39) missense probably benign 0.29
R1464:Map3k1 UTSW 13 111,892,405 (GRCm39) missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111,892,405 (GRCm39) missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111,893,684 (GRCm39) missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111,891,953 (GRCm39) missense probably benign 0.23
R1893:Map3k1 UTSW 13 111,904,567 (GRCm39) missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111,889,016 (GRCm39) missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111,892,322 (GRCm39) missense probably benign 0.00
R2239:Map3k1 UTSW 13 111,885,478 (GRCm39) missense probably benign 0.00
R3686:Map3k1 UTSW 13 111,890,425 (GRCm39) missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111,892,754 (GRCm39) missense probably benign 0.00
R4094:Map3k1 UTSW 13 111,892,696 (GRCm39) missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111,905,028 (GRCm39) missense probably benign 0.01
R4902:Map3k1 UTSW 13 111,909,146 (GRCm39) missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111,909,272 (GRCm39) missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111,892,654 (GRCm39) missense probably benign 0.20
R5855:Map3k1 UTSW 13 111,892,513 (GRCm39) missense probably benign 0.37
R6384:Map3k1 UTSW 13 111,887,064 (GRCm39) missense probably damaging 1.00
R6389:Map3k1 UTSW 13 111,905,975 (GRCm39) missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111,892,259 (GRCm39) missense probably damaging 0.99
R6509:Map3k1 UTSW 13 111,890,363 (GRCm39) missense possibly damaging 0.48
R6644:Map3k1 UTSW 13 111,888,983 (GRCm39) missense probably benign 0.07
R6900:Map3k1 UTSW 13 111,890,350 (GRCm39) missense probably benign 0.01
R6943:Map3k1 UTSW 13 111,909,246 (GRCm39) missense probably benign 0.30
R6946:Map3k1 UTSW 13 111,905,035 (GRCm39) nonsense probably null
R7059:Map3k1 UTSW 13 111,909,312 (GRCm39) missense probably benign
R7271:Map3k1 UTSW 13 111,893,231 (GRCm39) missense probably benign 0.32
R7290:Map3k1 UTSW 13 111,904,645 (GRCm39) missense probably damaging 1.00
R7397:Map3k1 UTSW 13 111,891,742 (GRCm39) missense probably damaging 0.98
R7457:Map3k1 UTSW 13 111,892,789 (GRCm39) missense probably damaging 0.99
R7827:Map3k1 UTSW 13 111,892,663 (GRCm39) missense probably benign
R7990:Map3k1 UTSW 13 111,892,696 (GRCm39) missense probably benign 0.28
R8110:Map3k1 UTSW 13 111,891,847 (GRCm39) missense probably damaging 0.98
R8119:Map3k1 UTSW 13 111,909,156 (GRCm39) missense possibly damaging 0.89
R8179:Map3k1 UTSW 13 111,885,581 (GRCm39) missense probably damaging 1.00
R8317:Map3k1 UTSW 13 111,894,696 (GRCm39) missense probably damaging 1.00
R8397:Map3k1 UTSW 13 111,892,138 (GRCm39) missense probably damaging 0.99
R8745:Map3k1 UTSW 13 111,893,306 (GRCm39) missense probably damaging 1.00
R8829:Map3k1 UTSW 13 111,889,015 (GRCm39) missense possibly damaging 0.88
R8832:Map3k1 UTSW 13 111,889,015 (GRCm39) missense possibly damaging 0.88
R8939:Map3k1 UTSW 13 111,892,837 (GRCm39) nonsense probably null
R9640:Map3k1 UTSW 13 111,900,699 (GRCm39) nonsense probably null
R9649:Map3k1 UTSW 13 111,885,478 (GRCm39) missense probably damaging 0.97
R9653:Map3k1 UTSW 13 111,890,296 (GRCm39) missense possibly damaging 0.94
R9768:Map3k1 UTSW 13 111,904,630 (GRCm39) missense probably benign 0.04
X0065:Map3k1 UTSW 13 111,893,639 (GRCm39) missense probably damaging 1.00
Z1177:Map3k1 UTSW 13 111,892,480 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCAAGGCGACAGGAAGTTG -3'
(R):5'- ACAGAATTCATGATGCGTGGTG -3'

Sequencing Primer
(F):5'- ACAGGAAGTTGAGCTCCTCACTTC -3'
(R):5'- GGTGGTTTTGTCCCTTACCGC -3'
Posted On 2022-11-14