Mutagenetix > Incidental Mutation

Incidental Mutation 'R9763:Rbbp8'

735844

Institutional Source

Beutler Lab

Gene Symbol

Rbbp8

Ensembl Gene

ENSMUSG00000041238

Gene Name

retinoblastoma binding protein 8, endonuclease

Synonyms

9930104E21Rik, CtIP

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11633276-11743207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11732204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 717 (M717L)

Ref Sequence

ENSEMBL: ENSMUSP00000046255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]

AlphaFold

Q80YR6

Predicted Effect

probably benign
Transcript: ENSMUST00000047322
AA Change: M717L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: M717L

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	9.6e-61	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	790	854	8.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115861
AA Change: M717L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: M717L

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	5.2e-55	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	817	854	1.4e-8	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,263,558	D2167E	possibly damaging	Het
Acadsb	T	A	7: 131,443,598	Y420N	probably benign	Het
Adcy1	T	A	11: 7,064,126	L176Q	probably damaging	Het
Amdhd1	T	A	10: 93,531,536	K252M	possibly damaging	Het
Aspa	C	A	11: 73,322,268	E83*	probably null	Het
Atat1	A	G	17: 35,910,007	L10P	probably damaging	Het
Ccdc141	T	A	2: 77,039,575	N862I	probably damaging	Het
Cdkal1	A	T	13: 29,625,709	C217*	probably null	Het
Cttnbp2	C	T	6: 18,435,241	S206N	probably benign	Het
Dner	A	T	1: 84,383,935	I651N	possibly damaging	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Ercc6l2	T	C	13: 63,834,624	V91A	probably damaging	Het
Fam198a	A	G	9: 121,976,355	D404G	probably damaging	Het
Gm11639	G	A	11: 104,999,659	G4189E	possibly damaging	Het
Gm13941	A	G	2: 111,101,173	L38S	unknown	Het
Golph3l	G	A	3: 95,609,774	E198K	possibly damaging	Het
Hecw2	A	C	1: 53,923,915	D812E	probably damaging	Het
Ikzf2	T	A	1: 69,548,676	E212V	possibly damaging	Het
Il6st	C	T	13: 112,490,517	S281F	probably damaging	Het
Kmt2d	CTGTTG	CTG	15: 98,845,176		probably benign	Het
Krt71	T	G	15: 101,738,322	K317T	probably damaging	Het
Lgi4	T	C	7: 31,060,595	F72S	probably damaging	Het
Map3k1	C	T	13: 111,775,965	R174H	probably damaging	Het
Marveld3	T	A	8: 109,961,743	H122L	probably benign	Het
Mrgprb2	A	G	7: 48,552,426	S184P	probably benign	Het
Mylk	G	T	16: 34,879,112	G282*	probably null	Het
Myo16	T	A	8: 10,400,528	M510K	unknown	Het
Naip5	C	G	13: 100,230,761	A276P	probably damaging	Het
Olfr1016	T	G	2: 85,799,716	N185H	possibly damaging	Het
Olfr1045	A	T	2: 86,197,837	M305K	probably benign	Het
Olfr1507	T	G	14: 52,490,850	Y38S	probably damaging	Het
Olfr411	T	C	11: 74,347,215	Y3C	probably damaging	Het
Olfr518	T	A	7: 108,881,667		probably benign	Het
Olfr519	T	G	7: 108,894,003	I140L	probably benign	Het
Pdzrn4	T	C	15: 92,770,495	Y843H	probably damaging	Het
Prkca	A	G	11: 108,013,041	V242A	possibly damaging	Het
Rnf150	T	C	8: 83,006,339	S272P	probably benign	Het
Rtraf	A	G	14: 19,816,246	V134A	probably damaging	Het
Rubcnl	T	A	14: 75,049,668	L592*	probably null	Het
Slc23a1	A	G	18: 35,622,311	S484P	probably damaging	Het
Slmap	A	G	14: 26,482,963	Y68H	probably damaging	Het
Speer4b	C	A	5: 27,500,208	V56L	probably damaging	Het
Sycp2l	T	A	13: 41,152,756	S84T		Het
Syne1	T	C	10: 5,057,858	D122G	probably benign	Het
Timd2	G	T	11: 46,682,713	P155T	probably benign	Het
Topbp1	G	A	9: 103,346,724	R1401Q	probably benign	Het
Trim36	C	A	18: 46,176,058	D312Y	probably benign	Het
Vps13c	A	G	9: 67,911,578	T1094A	probably benign	Het
Vwa8	T	A	14: 78,949,548	Y465N	probably damaging	Het
Zfpm1	T	C	8: 122,335,792	L530P	probably damaging	Het
Zmynd10	A	T	9: 107,548,766	T100S	probably benign	Het

Other mutations in Rbbp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Rbbp8	APN	18	11722607	missense	probably benign
IGL01302:Rbbp8	APN	18	11721979	missense	probably benign
IGL01965:Rbbp8	APN	18	11722260	missense	probably benign	0.04
IGL02076:Rbbp8	APN	18	11705819	missense	probably damaging	1.00
IGL02410:Rbbp8	APN	18	11732212	missense	probably damaging	1.00
IGL02823:Rbbp8	APN	18	11732213	missense	possibly damaging	0.89
IGL02859:Rbbp8	APN	18	11738614	missense	probably benign	0.42
IGL02966:Rbbp8	APN	18	11705812	missense	possibly damaging	0.88
IGL03022:Rbbp8	APN	18	11725502	splice site	probably benign
IGL03274:Rbbp8	APN	18	11741076	splice site	probably benign
IGL03367:Rbbp8	APN	18	11721719	missense	probably benign	0.08
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0167:Rbbp8	UTSW	18	11660922	nonsense	probably null
R0314:Rbbp8	UTSW	18	11715818	missense	probably benign	0.17
R0864:Rbbp8	UTSW	18	11732184	splice site	probably benign
R1033:Rbbp8	UTSW	18	11742705	missense	probably benign	0.41
R1678:Rbbp8	UTSW	18	11732315	missense	probably benign	0.05
R1964:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R2002:Rbbp8	UTSW	18	11727166	splice site	probably benign
R2015:Rbbp8	UTSW	18	11720624	missense	probably benign	0.01
R2240:Rbbp8	UTSW	18	11677669	missense	probably damaging	0.99
R2308:Rbbp8	UTSW	18	11696776	missense	possibly damaging	0.95
R3946:Rbbp8	UTSW	18	11718868	missense	probably benign
R4375:Rbbp8	UTSW	18	11725410	missense	probably benign	0.00
R4590:Rbbp8	UTSW	18	11732265	nonsense	probably null
R4695:Rbbp8	UTSW	18	11721782	nonsense	probably null
R4769:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R5161:Rbbp8	UTSW	18	11722114	missense	probably damaging	1.00
R5195:Rbbp8	UTSW	18	11722151	missense	probably benign	0.00
R5223:Rbbp8	UTSW	18	11721690	missense	probably benign	0.19
R5573:Rbbp8	UTSW	18	11722607	missense	probably benign
R5671:Rbbp8	UTSW	18	11742642	missense	probably benign	0.00
R6051:Rbbp8	UTSW	18	11738607	missense	probably benign	0.17
R6995:Rbbp8	UTSW	18	11718908	missense	probably damaging	1.00
R7048:Rbbp8	UTSW	18	11732220	missense	possibly damaging	0.92
R7261:Rbbp8	UTSW	18	11705742	missense	probably damaging	0.99
R7305:Rbbp8	UTSW	18	11672581	critical splice acceptor site	probably null
R7319:Rbbp8	UTSW	18	11732212	missense	probably damaging	1.00
R7447:Rbbp8	UTSW	18	11660877	missense	probably benign	0.00
R7949:Rbbp8	UTSW	18	11718835	missense	probably benign	0.00
R8010:Rbbp8	UTSW	18	11722233	missense	possibly damaging	0.67
R8116:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R8292:Rbbp8	UTSW	18	11705712	missense	probably benign
R8300:Rbbp8	UTSW	18	11705776	synonymous	silent
R8314:Rbbp8	UTSW	18	11720625	missense	probably benign	0.06
R8510:Rbbp8	UTSW	18	11696802	nonsense	probably null
R8961:Rbbp8	UTSW	18	11732205	missense	probably benign	0.18
R9056:Rbbp8	UTSW	18	11677620	missense	possibly damaging	0.65
R9086:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R9375:Rbbp8	UTSW	18	11705831	missense	probably benign
R9391:Rbbp8	UTSW	18	11721933	missense	possibly damaging	0.49
Z1176:Rbbp8	UTSW	18	11732262	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTAAGCACTTCAGCACTCTTG -3'
(R):5'- AGGCACATATGTGGTGTACAG -3'

Sequencing Primer
(F):5'- GCACTTCAGCACTCTTGAAGGTATAG -3'
(R):5'- TGTACAGACACATACACACAGG -3'

Posted On

2022-11-14