Incidental Mutation 'R9790:Garem2'
ID 735867
Institutional Source Beutler Lab
Gene Symbol Garem2
Ensembl Gene ENSMUSG00000044576
Gene Name GRB2 associated regulator of MAPK1 subtype 2
Synonyms Gareml, LOC242915, Fam59b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.233) question?
Stock # R9790 (G1)
Quality Score 133.008
Status Not validated
Chromosome 5
Chromosomal Location 30310194-30323378 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 30319747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 403 (A403E)
Ref Sequence ENSEMBL: ENSMUSP00000054208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058045] [ENSMUST00000156859]
AlphaFold Q6PAJ3
Predicted Effect probably benign
Transcript: ENSMUST00000058045
AA Change: A403E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054208
Gene: ENSMUSG00000044576
AA Change: A403E

DomainStartEndE-ValueType
Pfam:CABIT 29 337 1.2e-77 PFAM
low complexity region 379 405 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 524 534 N/A INTRINSIC
low complexity region 538 553 N/A INTRINSIC
low complexity region 569 588 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 686 696 N/A INTRINSIC
PDB:2DKZ|A 794 878 3e-30 PDB
Blast:SAM 812 879 6e-35 BLAST
SCOP:d1kw4a_ 816 877 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156859
SMART Domains Protein: ENSMUSP00000120976
Gene: ENSMUSG00000025745

DomainStartEndE-ValueType
Pfam:ECH_1 44 297 3.6e-42 PFAM
Pfam:ECH_2 49 225 8.6e-27 PFAM
Pfam:3HCDH_N 363 542 1e-54 PFAM
Pfam:3HCDH 544 639 7.7e-29 PFAM
low complexity region 706 720 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,748,604 (GRCm39) Y312H probably damaging Het
Abcc10 A T 17: 46,633,185 (GRCm39) I549N probably damaging Het
Agpat2 A G 2: 26,486,395 (GRCm39) Y134H probably damaging Het
Alms1 A G 6: 85,596,425 (GRCm39) D417G probably benign Het
Apol11b T A 15: 77,519,475 (GRCm39) I202F probably benign Het
Arap1 C A 7: 101,037,376 (GRCm39) Q468K probably benign Het
Arhgef4 T C 1: 34,832,445 (GRCm39) probably null Het
Asap3 A T 4: 135,961,914 (GRCm39) N285I probably damaging Het
Aspm A T 1: 139,408,375 (GRCm39) I2421F probably damaging Het
Banp C A 8: 122,701,285 (GRCm39) D17E probably benign Het
Bsx T G 9: 40,788,905 (GRCm39) V154G probably damaging Het
Cacnb1 T C 11: 97,900,186 (GRCm39) D324G probably damaging Het
Ccdc170 A T 10: 4,483,957 (GRCm39) probably null Het
Ccdc187 T C 2: 26,171,227 (GRCm39) H417R probably benign Het
Cct4 T A 11: 22,949,070 (GRCm39) M272K probably damaging Het
Chd9 A G 8: 91,760,417 (GRCm39) E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 (GRCm39) S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,027 (GRCm39) H1504L probably benign Het
Cyp4a29 T A 4: 115,108,380 (GRCm39) M368K probably damaging Het
Dhx32 A G 7: 133,326,267 (GRCm39) F527L probably benign Het
Foxk1 T C 5: 142,387,739 (GRCm39) V154A probably damaging Het
Frem3 G A 8: 81,339,890 (GRCm39) E728K probably benign Het
Gemin5 G A 11: 58,020,846 (GRCm39) Q1114* probably null Het
Gm11567 C T 11: 99,770,274 (GRCm39) R71C unknown Het
Gm13272 T C 4: 88,698,442 (GRCm39) V119A probably benign Het
Gpc6 T A 14: 117,163,435 (GRCm39) C30S probably damaging Het
Gprc6a A C 10: 51,491,395 (GRCm39) F785V probably damaging Het
Hormad1 T C 3: 95,494,693 (GRCm39) V368A probably benign Het
Hsd17b4 G A 18: 50,324,907 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il17ra C T 6: 120,459,240 (GRCm39) S797F probably damaging Het
Jmjd6 A G 11: 116,733,438 (GRCm39) S80P probably benign Het
Klhdc2 T A 12: 69,346,995 (GRCm39) N53K probably benign Het
Klhl30 C T 1: 91,282,089 (GRCm39) P230L probably benign Het
Marchf1 C A 8: 66,729,339 (GRCm39) A46E probably benign Het
Mast4 T C 13: 102,890,705 (GRCm39) T1050A probably benign Het
Mpp7 T C 18: 7,355,049 (GRCm39) N459S probably benign Het
Mtfr1l A G 4: 134,258,063 (GRCm39) V53A probably benign Het
Myh11 T A 16: 14,025,992 (GRCm39) E1326V Het
Myh3 A G 11: 66,992,005 (GRCm39) E1850G probably damaging Het
Myo16 A G 8: 10,619,925 (GRCm39) D1492G unknown Het
Myo3b C A 2: 70,180,287 (GRCm39) H1219Q probably benign Het
Nphp4 A T 4: 152,646,605 (GRCm39) Q1379L probably null Het
Or8g30 C T 9: 39,230,815 (GRCm39) V32I probably benign Het
Or9q1 A G 19: 13,804,914 (GRCm39) I282T probably benign Het
Osbpl6 T G 2: 76,385,361 (GRCm39) L265R probably damaging Het
Pld4 A G 12: 112,734,862 (GRCm39) T440A probably damaging Het
Prr14 T C 7: 127,071,128 (GRCm39) M1T probably null Het
Ptger4 A T 15: 5,273,178 (GRCm39) M1K probably null Het
Ptpn22 A T 3: 103,795,842 (GRCm39) T608S possibly damaging Het
S1pr2 A G 9: 20,879,319 (GRCm39) W170R probably damaging Het
Specc1l A G 10: 75,066,603 (GRCm39) I17M probably benign Het
Spmap1 T A 11: 97,666,594 (GRCm39) I31F probably benign Het
Sptbn4 C G 7: 27,071,662 (GRCm39) G1601R probably damaging Het
Sqor C T 2: 122,626,912 (GRCm39) P11L probably benign Het
Stac2 T C 11: 97,934,449 (GRCm39) D85G probably benign Het
Svs5 G A 2: 164,078,918 (GRCm39) Q330* probably null Het
Taar7e A G 10: 23,913,554 (GRCm39) I15V probably benign Het
Tcf4 A T 18: 69,770,007 (GRCm39) Y275F probably damaging Het
Tenm4 A G 7: 96,538,046 (GRCm39) N1873S probably damaging Het
Tert T A 13: 73,775,648 (GRCm39) V133D probably benign Het
Tfap2a T A 13: 40,870,658 (GRCm39) N410I probably damaging Het
Tjp3 A T 10: 81,109,694 (GRCm39) D836E probably benign Het
Tox3 A T 8: 90,975,206 (GRCm39) M475K unknown Het
Traf4 A T 11: 78,050,979 (GRCm39) D392E probably damaging Het
Vav2 A G 2: 27,181,825 (GRCm39) L338P probably damaging Het
Vmn1r81 T C 7: 11,994,113 (GRCm39) N165S probably benign Het
Vmn2r9 A T 5: 108,995,409 (GRCm39) V413E probably damaging Het
Wdr7 A T 18: 63,911,059 (GRCm39) D817V probably damaging Het
Zbtb38 G A 9: 96,570,700 (GRCm39) S128L probably damaging Het
Zfhx4 T A 3: 5,464,922 (GRCm39) H1718Q probably damaging Het
Zfp945 G A 17: 23,071,228 (GRCm39) H245Y probably benign Het
Other mutations in Garem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0194:Garem2 UTSW 5 30,318,928 (GRCm39) missense probably damaging 1.00
R0458:Garem2 UTSW 5 30,319,180 (GRCm39) missense probably damaging 0.99
R1933:Garem2 UTSW 5 30,319,860 (GRCm39) nonsense probably null
R1955:Garem2 UTSW 5 30,313,268 (GRCm39) missense probably benign 0.36
R1970:Garem2 UTSW 5 30,322,172 (GRCm39) nonsense probably null
R2152:Garem2 UTSW 5 30,313,297 (GRCm39) missense probably damaging 0.99
R2153:Garem2 UTSW 5 30,313,297 (GRCm39) missense probably damaging 0.99
R2154:Garem2 UTSW 5 30,313,297 (GRCm39) missense probably damaging 0.99
R2202:Garem2 UTSW 5 30,319,762 (GRCm39) missense probably benign 0.43
R2270:Garem2 UTSW 5 30,321,972 (GRCm39) missense probably damaging 1.00
R2271:Garem2 UTSW 5 30,321,972 (GRCm39) missense probably damaging 1.00
R4348:Garem2 UTSW 5 30,310,366 (GRCm39) missense possibly damaging 0.63
R4439:Garem2 UTSW 5 30,318,344 (GRCm39) missense possibly damaging 0.94
R4665:Garem2 UTSW 5 30,319,665 (GRCm39) missense probably damaging 0.98
R4666:Garem2 UTSW 5 30,319,665 (GRCm39) missense probably damaging 0.98
R5733:Garem2 UTSW 5 30,321,336 (GRCm39) missense probably damaging 1.00
R5851:Garem2 UTSW 5 30,319,288 (GRCm39) missense probably damaging 1.00
R6416:Garem2 UTSW 5 30,321,735 (GRCm39) nonsense probably null
R6998:Garem2 UTSW 5 30,319,168 (GRCm39) missense possibly damaging 0.88
R8080:Garem2 UTSW 5 30,313,385 (GRCm39) missense probably damaging 1.00
R9031:Garem2 UTSW 5 30,313,262 (GRCm39) missense possibly damaging 0.93
R9199:Garem2 UTSW 5 30,319,471 (GRCm39) missense probably damaging 0.98
R9327:Garem2 UTSW 5 30,321,989 (GRCm39) missense probably benign
R9502:Garem2 UTSW 5 30,321,750 (GRCm39) missense possibly damaging 0.94
R9787:Garem2 UTSW 5 30,319,219 (GRCm39) missense probably damaging 1.00
R9789:Garem2 UTSW 5 30,319,330 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCTGCTTACGGACAC -3'
(R):5'- CTTCAAGGTGAAGCAGAACTCACTC -3'

Sequencing Primer
(F):5'- GCTTCACTCTGCCGCAG -3'
(R):5'- CCTCGGATTTGGGAGGGACAG -3'
Posted On 2022-11-14