Incidental Mutation 'R9790:Tenm4'
ID 735876
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9790 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 96171246-96911093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96888839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1873 (N1873S)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: N1865S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: N1865S

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: N1873S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: N1873S

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107166
AA Change: N1836S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: N1836S

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik T A 11: 97,775,768 I31F probably benign Het
Abcb1a T C 5: 8,698,604 Y312H probably damaging Het
Abcc10 A T 17: 46,322,259 I549N probably damaging Het
Agpat2 A G 2: 26,596,383 Y134H probably damaging Het
Alms1 A G 6: 85,619,443 D417G probably benign Het
Apol11b T A 15: 77,635,275 I202F probably benign Het
Arap1 C A 7: 101,388,169 Q468K probably benign Het
Arhgef4 T C 1: 34,793,364 probably null Het
Asap3 A T 4: 136,234,603 N285I probably damaging Het
Aspm A T 1: 139,480,637 I2421F probably damaging Het
Banp C A 8: 121,974,546 D17E probably benign Het
Bsx T G 9: 40,877,609 V154G probably damaging Het
Cacnb1 T C 11: 98,009,360 D324G probably damaging Het
Ccdc170 A T 10: 4,533,957 probably null Het
Ccdc187 T C 2: 26,281,215 H417R probably benign Het
Cct4 T A 11: 22,999,070 M272K probably damaging Het
Chd9 A G 8: 91,033,789 E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,028 H1504L probably benign Het
Cyp4a29 T A 4: 115,251,183 M368K probably damaging Het
Dhx32 A G 7: 133,724,538 F527L probably benign Het
Foxk1 T C 5: 142,401,984 V154A probably damaging Het
Frem3 G A 8: 80,613,261 E728K probably benign Het
Garem2 C A 5: 30,114,749 A403E probably benign Het
Gemin5 G A 11: 58,130,020 Q1114* probably null Het
Gm11567 C T 11: 99,879,448 R71C unknown Het
Gm13272 T C 4: 88,780,205 V119A probably benign Het
Gpc6 T A 14: 116,926,023 C30S probably damaging Het
Gprc6a A C 10: 51,615,299 F785V probably damaging Het
Hormad1 T C 3: 95,587,382 V368A probably benign Het
Hsd17b4 G A 18: 50,191,840 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il17ra C T 6: 120,482,279 S797F probably damaging Het
Jmjd6 A G 11: 116,842,612 S80P probably benign Het
Klhdc2 T A 12: 69,300,221 N53K probably benign Het
Klhl30 C T 1: 91,354,367 P230L probably benign Het
March1 C A 8: 66,276,687 A46E probably benign Het
Mast4 T C 13: 102,754,197 T1050A probably benign Het
Mpp7 T C 18: 7,355,049 N459S probably benign Het
Mtfr1l A G 4: 134,530,752 V53A probably benign Het
Myh11 T A 16: 14,208,128 E1326V Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Myo16 A G 8: 10,569,925 D1492G unknown Het
Myo3b C A 2: 70,349,943 H1219Q probably benign Het
Nphp4 A T 4: 152,562,148 Q1379L probably null Het
Olfr1500 A G 19: 13,827,550 I282T probably benign Het
Olfr948 C T 9: 39,319,519 V32I probably benign Het
Osbpl6 T G 2: 76,555,017 L265R probably damaging Het
Pld4 A G 12: 112,768,428 T440A probably damaging Het
Prr14 T C 7: 127,471,956 M1T probably null Het
Ptger4 A T 15: 5,243,697 M1K probably null Het
Ptpn22 A T 3: 103,888,526 T608S possibly damaging Het
S1pr2 A G 9: 20,968,023 W170R probably damaging Het
Specc1l A G 10: 75,230,769 I17M probably benign Het
Sptbn4 C G 7: 27,372,237 G1601R probably damaging Het
Sqor C T 2: 122,784,992 P11L probably benign Het
Stac2 T C 11: 98,043,623 D85G probably benign Het
Svs2 G A 2: 164,236,998 Q330* probably null Het
Taar7e A G 10: 24,037,656 I15V probably benign Het
Tcf4 A T 18: 69,636,936 Y275F probably damaging Het
Tert T A 13: 73,627,529 V133D probably benign Het
Tfap2a T A 13: 40,717,182 N410I probably damaging Het
Tjp3 A T 10: 81,273,860 D836E probably benign Het
Tox3 A T 8: 90,248,578 M475K unknown Het
Traf4 A T 11: 78,160,153 D392E probably damaging Het
Vav2 A G 2: 27,291,813 L338P probably damaging Het
Vmn1r81 T C 7: 12,260,186 N165S probably benign Het
Vmn2r9 A T 5: 108,847,543 V413E probably damaging Het
Wdr7 A T 18: 63,777,988 D817V probably damaging Het
Zbtb38 G A 9: 96,688,647 S128L probably damaging Het
Zfhx4 T A 3: 5,399,862 H1718Q probably damaging Het
Zfp945 G A 17: 22,852,254 H245Y probably benign Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 splice site probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96773987 missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96874213 missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96774146 missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96845808 missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96837314 missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96848017 missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96888814 missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96845926 missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96895985 missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96893014 missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96863533 missense probably benign 0.00
R7692:Tenm4 UTSW 7 96895403 missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96894702 missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96895692 missense probably benign 0.38
R7792:Tenm4 UTSW 7 96774014 missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96873874 missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96906380 missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96852357 missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96874305 missense probably benign 0.44
R8017:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96729346 splice site probably benign
R8061:Tenm4 UTSW 7 96852456 missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96854728 missense probably benign 0.39
R8140:Tenm4 UTSW 7 96895176 missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96895407 missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96772106 critical splice donor site probably null
R8542:Tenm4 UTSW 7 96811932 missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96905941 missense probably benign
R8670:Tenm4 UTSW 7 96905941 missense probably benign
R8683:Tenm4 UTSW 7 96902857 missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96905941 missense probably benign
R8692:Tenm4 UTSW 7 96905941 missense probably benign
R8714:Tenm4 UTSW 7 96905941 missense probably benign
R8716:Tenm4 UTSW 7 96905941 missense probably benign
R8735:Tenm4 UTSW 7 96905941 missense probably benign
R8736:Tenm4 UTSW 7 96905941 missense probably benign
R8737:Tenm4 UTSW 7 96905941 missense probably benign
R8738:Tenm4 UTSW 7 96873840 missense probably damaging 1.00
R8738:Tenm4 UTSW 7 96905941 missense probably benign
R8739:Tenm4 UTSW 7 96905941 missense probably benign
R8776:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96874128 missense probably benign 0.01
R8851:Tenm4 UTSW 7 96852503 missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96702745 splice site probably benign
R8977:Tenm4 UTSW 7 96811970 missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96845854 missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96823918 missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96823873 missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96772027 missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96892919 missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96885439 missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96896145 missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96896160 missense probably benign
R9466:Tenm4 UTSW 7 96550045 missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96823849 missense probably benign
R9626:Tenm4 UTSW 7 96896138 missense probably damaging 1.00
R9673:Tenm4 UTSW 7 96867989 missense probably damaging 1.00
R9676:Tenm4 UTSW 7 96895431 missense probably damaging 1.00
R9678:Tenm4 UTSW 7 96737412 missense possibly damaging 0.94
R9775:Tenm4 UTSW 7 96906554 missense possibly damaging 0.92
R9791:Tenm4 UTSW 7 96888839 missense probably damaging 1.00
R9803:Tenm4 UTSW 7 96553478 missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96905914 missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96863585 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGACCAAGTCCGGAACAG -3'
(R):5'- GCCTTTTGTTACACGTGGC -3'

Sequencing Primer
(F):5'- AGCTACTACATCGGGGCTGATG -3'
(R):5'- CTCCCTTTGGTAGATGAAGAAACTGG -3'
Posted On 2022-11-14