Incidental Mutation 'R9790:Myo16'
ID 735880
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Name myosin XVI
Synonyms C230040D10Rik, BM140241, Nyap3
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.325) question?
Stock # R9790 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 10203911-10684742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10619925 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1492 (D1492G)
Ref Sequence ENSEMBL: ENSMUSP00000146677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
AlphaFold Q5DU14
Predicted Effect possibly damaging
Transcript: ENSMUST00000042103
AA Change: D1492G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: D1492G

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: D1436G
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: D1492G
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,748,604 (GRCm39) Y312H probably damaging Het
Abcc10 A T 17: 46,633,185 (GRCm39) I549N probably damaging Het
Agpat2 A G 2: 26,486,395 (GRCm39) Y134H probably damaging Het
Alms1 A G 6: 85,596,425 (GRCm39) D417G probably benign Het
Apol11b T A 15: 77,519,475 (GRCm39) I202F probably benign Het
Arap1 C A 7: 101,037,376 (GRCm39) Q468K probably benign Het
Arhgef4 T C 1: 34,832,445 (GRCm39) probably null Het
Asap3 A T 4: 135,961,914 (GRCm39) N285I probably damaging Het
Aspm A T 1: 139,408,375 (GRCm39) I2421F probably damaging Het
Banp C A 8: 122,701,285 (GRCm39) D17E probably benign Het
Bsx T G 9: 40,788,905 (GRCm39) V154G probably damaging Het
Cacnb1 T C 11: 97,900,186 (GRCm39) D324G probably damaging Het
Ccdc170 A T 10: 4,483,957 (GRCm39) probably null Het
Ccdc187 T C 2: 26,171,227 (GRCm39) H417R probably benign Het
Cct4 T A 11: 22,949,070 (GRCm39) M272K probably damaging Het
Chd9 A G 8: 91,760,417 (GRCm39) E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 (GRCm39) S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,027 (GRCm39) H1504L probably benign Het
Cyp4a29 T A 4: 115,108,380 (GRCm39) M368K probably damaging Het
Dhx32 A G 7: 133,326,267 (GRCm39) F527L probably benign Het
Foxk1 T C 5: 142,387,739 (GRCm39) V154A probably damaging Het
Frem3 G A 8: 81,339,890 (GRCm39) E728K probably benign Het
Garem2 C A 5: 30,319,747 (GRCm39) A403E probably benign Het
Gemin5 G A 11: 58,020,846 (GRCm39) Q1114* probably null Het
Gm11567 C T 11: 99,770,274 (GRCm39) R71C unknown Het
Gm13272 T C 4: 88,698,442 (GRCm39) V119A probably benign Het
Gpc6 T A 14: 117,163,435 (GRCm39) C30S probably damaging Het
Gprc6a A C 10: 51,491,395 (GRCm39) F785V probably damaging Het
Hormad1 T C 3: 95,494,693 (GRCm39) V368A probably benign Het
Hsd17b4 G A 18: 50,324,907 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il17ra C T 6: 120,459,240 (GRCm39) S797F probably damaging Het
Jmjd6 A G 11: 116,733,438 (GRCm39) S80P probably benign Het
Klhdc2 T A 12: 69,346,995 (GRCm39) N53K probably benign Het
Klhl30 C T 1: 91,282,089 (GRCm39) P230L probably benign Het
Marchf1 C A 8: 66,729,339 (GRCm39) A46E probably benign Het
Mast4 T C 13: 102,890,705 (GRCm39) T1050A probably benign Het
Mpp7 T C 18: 7,355,049 (GRCm39) N459S probably benign Het
Mtfr1l A G 4: 134,258,063 (GRCm39) V53A probably benign Het
Myh11 T A 16: 14,025,992 (GRCm39) E1326V Het
Myh3 A G 11: 66,992,005 (GRCm39) E1850G probably damaging Het
Myo3b C A 2: 70,180,287 (GRCm39) H1219Q probably benign Het
Nphp4 A T 4: 152,646,605 (GRCm39) Q1379L probably null Het
Or8g30 C T 9: 39,230,815 (GRCm39) V32I probably benign Het
Or9q1 A G 19: 13,804,914 (GRCm39) I282T probably benign Het
Osbpl6 T G 2: 76,385,361 (GRCm39) L265R probably damaging Het
Pld4 A G 12: 112,734,862 (GRCm39) T440A probably damaging Het
Prr14 T C 7: 127,071,128 (GRCm39) M1T probably null Het
Ptger4 A T 15: 5,273,178 (GRCm39) M1K probably null Het
Ptpn22 A T 3: 103,795,842 (GRCm39) T608S possibly damaging Het
S1pr2 A G 9: 20,879,319 (GRCm39) W170R probably damaging Het
Specc1l A G 10: 75,066,603 (GRCm39) I17M probably benign Het
Spmap1 T A 11: 97,666,594 (GRCm39) I31F probably benign Het
Sptbn4 C G 7: 27,071,662 (GRCm39) G1601R probably damaging Het
Sqor C T 2: 122,626,912 (GRCm39) P11L probably benign Het
Stac2 T C 11: 97,934,449 (GRCm39) D85G probably benign Het
Svs5 G A 2: 164,078,918 (GRCm39) Q330* probably null Het
Taar7e A G 10: 23,913,554 (GRCm39) I15V probably benign Het
Tcf4 A T 18: 69,770,007 (GRCm39) Y275F probably damaging Het
Tenm4 A G 7: 96,538,046 (GRCm39) N1873S probably damaging Het
Tert T A 13: 73,775,648 (GRCm39) V133D probably benign Het
Tfap2a T A 13: 40,870,658 (GRCm39) N410I probably damaging Het
Tjp3 A T 10: 81,109,694 (GRCm39) D836E probably benign Het
Tox3 A T 8: 90,975,206 (GRCm39) M475K unknown Het
Traf4 A T 11: 78,050,979 (GRCm39) D392E probably damaging Het
Vav2 A G 2: 27,181,825 (GRCm39) L338P probably damaging Het
Vmn1r81 T C 7: 11,994,113 (GRCm39) N165S probably benign Het
Vmn2r9 A T 5: 108,995,409 (GRCm39) V413E probably damaging Het
Wdr7 A T 18: 63,911,059 (GRCm39) D817V probably damaging Het
Zbtb38 G A 9: 96,570,700 (GRCm39) S128L probably damaging Het
Zfhx4 T A 3: 5,464,922 (GRCm39) H1718Q probably damaging Het
Zfp945 G A 17: 23,071,228 (GRCm39) H245Y probably benign Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10,488,889 (GRCm39) missense probably damaging 1.00
IGL00567:Myo16 APN 8 10,512,154 (GRCm39) missense probably damaging 1.00
IGL00671:Myo16 APN 8 10,411,067 (GRCm39) missense probably damaging 1.00
IGL00897:Myo16 APN 8 10,365,518 (GRCm39) missense probably damaging 1.00
IGL01458:Myo16 APN 8 10,485,853 (GRCm39) missense probably damaging 1.00
IGL01523:Myo16 APN 8 10,420,908 (GRCm39) missense probably damaging 1.00
IGL01532:Myo16 APN 8 10,450,551 (GRCm39) missense probably benign 0.00
IGL01680:Myo16 APN 8 10,322,630 (GRCm39) missense probably damaging 1.00
IGL01747:Myo16 APN 8 10,654,877 (GRCm39) missense probably damaging 1.00
IGL02084:Myo16 APN 8 10,411,088 (GRCm39) missense probably damaging 0.99
IGL02203:Myo16 APN 8 10,620,132 (GRCm39) missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10,440,217 (GRCm39) missense probably damaging 1.00
IGL02819:Myo16 APN 8 10,372,600 (GRCm39) missense probably damaging 1.00
IGL02935:Myo16 APN 8 10,582,990 (GRCm39) missense probably benign 0.41
IGL02943:Myo16 APN 8 10,450,595 (GRCm39) splice site probably benign
IGL03347:Myo16 APN 8 10,426,120 (GRCm39) critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10,488,869 (GRCm39) missense probably damaging 0.99
P0016:Myo16 UTSW 8 10,450,596 (GRCm39) splice site probably benign
R0006:Myo16 UTSW 8 10,525,988 (GRCm39) missense probably damaging 0.98
R0006:Myo16 UTSW 8 10,525,988 (GRCm39) missense probably damaging 0.98
R0033:Myo16 UTSW 8 10,420,955 (GRCm39) missense probably damaging 1.00
R0033:Myo16 UTSW 8 10,420,955 (GRCm39) missense probably damaging 1.00
R0142:Myo16 UTSW 8 10,619,790 (GRCm39) missense probably benign 0.01
R0195:Myo16 UTSW 8 10,365,538 (GRCm39) splice site probably benign
R0418:Myo16 UTSW 8 10,619,918 (GRCm39) missense probably benign 0.01
R0576:Myo16 UTSW 8 10,612,318 (GRCm39) critical splice donor site probably null
R0627:Myo16 UTSW 8 10,489,689 (GRCm39) missense probably benign 0.15
R0826:Myo16 UTSW 8 10,426,285 (GRCm39) splice site probably benign
R0835:Myo16 UTSW 8 10,322,766 (GRCm39) missense probably damaging 1.00
R1015:Myo16 UTSW 8 10,440,183 (GRCm39) missense probably benign 0.17
R1052:Myo16 UTSW 8 10,620,181 (GRCm39) missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10,446,908 (GRCm39) missense probably damaging 1.00
R1185:Myo16 UTSW 8 10,683,624 (GRCm39) missense probably damaging 1.00
R1185:Myo16 UTSW 8 10,683,624 (GRCm39) missense probably damaging 1.00
R1474:Myo16 UTSW 8 10,552,796 (GRCm39) missense probably damaging 1.00
R1484:Myo16 UTSW 8 10,610,145 (GRCm39) missense probably damaging 1.00
R1503:Myo16 UTSW 8 10,552,817 (GRCm39) missense probably benign 0.44
R1733:Myo16 UTSW 8 10,492,283 (GRCm39) missense probably damaging 0.98
R1873:Myo16 UTSW 8 10,322,789 (GRCm39) missense probably damaging 1.00
R1885:Myo16 UTSW 8 10,372,656 (GRCm39) missense probably damaging 1.00
R1943:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10,552,796 (GRCm39) missense probably damaging 1.00
R2019:Myo16 UTSW 8 10,426,260 (GRCm39) missense probably benign 0.05
R2022:Myo16 UTSW 8 10,322,633 (GRCm39) missense probably benign 0.08
R2214:Myo16 UTSW 8 10,488,803 (GRCm39) missense probably damaging 1.00
R2228:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10,644,820 (GRCm39) missense probably benign 0.43
R3402:Myo16 UTSW 8 10,434,719 (GRCm39) missense probably benign
R3870:Myo16 UTSW 8 10,492,239 (GRCm39) missense probably benign 0.25
R4080:Myo16 UTSW 8 10,612,240 (GRCm39) missense probably damaging 1.00
R4498:Myo16 UTSW 8 10,485,869 (GRCm39) missense probably benign 0.01
R4631:Myo16 UTSW 8 10,556,984 (GRCm39) missense probably damaging 1.00
R4689:Myo16 UTSW 8 10,488,890 (GRCm39) missense probably damaging 1.00
R4736:Myo16 UTSW 8 10,423,527 (GRCm39) missense probably damaging 1.00
R4738:Myo16 UTSW 8 10,423,527 (GRCm39) missense probably damaging 1.00
R4739:Myo16 UTSW 8 10,423,527 (GRCm39) missense probably damaging 1.00
R4764:Myo16 UTSW 8 10,485,880 (GRCm39) missense probably damaging 1.00
R4778:Myo16 UTSW 8 10,619,694 (GRCm39) missense probably damaging 0.97
R4852:Myo16 UTSW 8 10,423,474 (GRCm39) missense probably damaging 1.00
R4885:Myo16 UTSW 8 10,488,892 (GRCm39) missense probably damaging 0.98
R4993:Myo16 UTSW 8 10,526,094 (GRCm39) missense probably damaging 0.99
R5077:Myo16 UTSW 8 10,372,658 (GRCm39) missense probably damaging 1.00
R5135:Myo16 UTSW 8 10,526,114 (GRCm39) missense probably benign
R5170:Myo16 UTSW 8 10,619,745 (GRCm39) missense probably benign 0.30
R5203:Myo16 UTSW 8 10,410,995 (GRCm39) missense probably damaging 1.00
R5246:Myo16 UTSW 8 10,612,212 (GRCm39) nonsense probably null
R5517:Myo16 UTSW 8 10,610,226 (GRCm39) missense probably benign 0.22
R5567:Myo16 UTSW 8 10,372,676 (GRCm39) missense probably damaging 1.00
R5694:Myo16 UTSW 8 10,619,606 (GRCm39) missense probably benign 0.01
R5749:Myo16 UTSW 8 10,463,245 (GRCm39) missense probably benign 0.01
R6131:Myo16 UTSW 8 10,619,877 (GRCm39) missense probably benign
R6213:Myo16 UTSW 8 10,420,963 (GRCm39) critical splice donor site probably null
R6216:Myo16 UTSW 8 10,365,494 (GRCm39) missense probably benign 0.01
R6240:Myo16 UTSW 8 10,420,930 (GRCm39) missense probably damaging 1.00
R6628:Myo16 UTSW 8 10,620,638 (GRCm39) missense probably damaging 0.99
R6935:Myo16 UTSW 8 10,619,820 (GRCm39) missense probably benign 0.37
R6996:Myo16 UTSW 8 10,619,496 (GRCm39) missense probably damaging 1.00
R7103:Myo16 UTSW 8 10,619,673 (GRCm39) missense unknown
R7164:Myo16 UTSW 8 10,619,585 (GRCm39) missense unknown
R7255:Myo16 UTSW 8 10,549,169 (GRCm39) missense unknown
R7266:Myo16 UTSW 8 10,322,687 (GRCm39) missense unknown
R7319:Myo16 UTSW 8 10,526,185 (GRCm39) splice site probably null
R7398:Myo16 UTSW 8 10,612,183 (GRCm39) missense unknown
R7442:Myo16 UTSW 8 10,322,537 (GRCm39) missense probably damaging 1.00
R7498:Myo16 UTSW 8 10,450,589 (GRCm39) missense unknown
R7539:Myo16 UTSW 8 10,411,095 (GRCm39) critical splice donor site probably null
R7622:Myo16 UTSW 8 10,426,238 (GRCm39) missense unknown
R7794:Myo16 UTSW 8 10,619,913 (GRCm39) missense unknown
R7903:Myo16 UTSW 8 10,426,265 (GRCm39) missense probably null
R8055:Myo16 UTSW 8 10,612,186 (GRCm39) missense unknown
R8078:Myo16 UTSW 8 10,612,078 (GRCm39) missense unknown
R8081:Myo16 UTSW 8 10,372,743 (GRCm39) missense unknown
R8679:Myo16 UTSW 8 10,411,042 (GRCm39) missense unknown
R8700:Myo16 UTSW 8 10,463,172 (GRCm39) missense unknown
R8939:Myo16 UTSW 8 10,524,679 (GRCm39) missense probably damaging 0.99
R8955:Myo16 UTSW 8 10,426,175 (GRCm39) missense probably damaging 1.00
R8968:Myo16 UTSW 8 10,619,700 (GRCm39) missense unknown
R9187:Myo16 UTSW 8 10,492,233 (GRCm39) missense unknown
R9219:Myo16 UTSW 8 10,492,236 (GRCm39) missense unknown
R9287:Myo16 UTSW 8 10,526,114 (GRCm39) missense unknown
R9327:Myo16 UTSW 8 10,489,705 (GRCm39) critical splice donor site probably null
R9763:Myo16 UTSW 8 10,450,528 (GRCm39) missense unknown
R9765:Myo16 UTSW 8 10,620,401 (GRCm39) missense probably damaging 0.97
R9791:Myo16 UTSW 8 10,619,925 (GRCm39) missense unknown
X0066:Myo16 UTSW 8 10,426,185 (GRCm39) missense probably damaging 1.00
Z1177:Myo16 UTSW 8 10,524,691 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGTGTACATCGAGATGGTG -3'
(R):5'- TACTGTGGTGACAAGGGACTG -3'

Sequencing Primer
(F):5'- TGGATCTGAGACCGACAGC -3'
(R):5'- TGACAAGGGACTGGAGCCTTC -3'
Posted On 2022-11-14