Incidental Mutation 'R9790:Gprc6a'
ID 735892
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9790 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 51491395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 785 (F785V)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: F785V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: F785V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218684
AA Change: F610V

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: F714V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,748,604 (GRCm39) Y312H probably damaging Het
Abcc10 A T 17: 46,633,185 (GRCm39) I549N probably damaging Het
Agpat2 A G 2: 26,486,395 (GRCm39) Y134H probably damaging Het
Alms1 A G 6: 85,596,425 (GRCm39) D417G probably benign Het
Apol11b T A 15: 77,519,475 (GRCm39) I202F probably benign Het
Arap1 C A 7: 101,037,376 (GRCm39) Q468K probably benign Het
Arhgef4 T C 1: 34,832,445 (GRCm39) probably null Het
Asap3 A T 4: 135,961,914 (GRCm39) N285I probably damaging Het
Aspm A T 1: 139,408,375 (GRCm39) I2421F probably damaging Het
Banp C A 8: 122,701,285 (GRCm39) D17E probably benign Het
Bsx T G 9: 40,788,905 (GRCm39) V154G probably damaging Het
Cacnb1 T C 11: 97,900,186 (GRCm39) D324G probably damaging Het
Ccdc170 A T 10: 4,483,957 (GRCm39) probably null Het
Ccdc187 T C 2: 26,171,227 (GRCm39) H417R probably benign Het
Cct4 T A 11: 22,949,070 (GRCm39) M272K probably damaging Het
Chd9 A G 8: 91,760,417 (GRCm39) E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 (GRCm39) S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,027 (GRCm39) H1504L probably benign Het
Cyp4a29 T A 4: 115,108,380 (GRCm39) M368K probably damaging Het
Dhx32 A G 7: 133,326,267 (GRCm39) F527L probably benign Het
Foxk1 T C 5: 142,387,739 (GRCm39) V154A probably damaging Het
Frem3 G A 8: 81,339,890 (GRCm39) E728K probably benign Het
Garem2 C A 5: 30,319,747 (GRCm39) A403E probably benign Het
Gemin5 G A 11: 58,020,846 (GRCm39) Q1114* probably null Het
Gm11567 C T 11: 99,770,274 (GRCm39) R71C unknown Het
Gm13272 T C 4: 88,698,442 (GRCm39) V119A probably benign Het
Gpc6 T A 14: 117,163,435 (GRCm39) C30S probably damaging Het
Hormad1 T C 3: 95,494,693 (GRCm39) V368A probably benign Het
Hsd17b4 G A 18: 50,324,907 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il17ra C T 6: 120,459,240 (GRCm39) S797F probably damaging Het
Jmjd6 A G 11: 116,733,438 (GRCm39) S80P probably benign Het
Klhdc2 T A 12: 69,346,995 (GRCm39) N53K probably benign Het
Klhl30 C T 1: 91,282,089 (GRCm39) P230L probably benign Het
Marchf1 C A 8: 66,729,339 (GRCm39) A46E probably benign Het
Mast4 T C 13: 102,890,705 (GRCm39) T1050A probably benign Het
Mpp7 T C 18: 7,355,049 (GRCm39) N459S probably benign Het
Mtfr1l A G 4: 134,258,063 (GRCm39) V53A probably benign Het
Myh11 T A 16: 14,025,992 (GRCm39) E1326V Het
Myh3 A G 11: 66,992,005 (GRCm39) E1850G probably damaging Het
Myo16 A G 8: 10,619,925 (GRCm39) D1492G unknown Het
Myo3b C A 2: 70,180,287 (GRCm39) H1219Q probably benign Het
Nphp4 A T 4: 152,646,605 (GRCm39) Q1379L probably null Het
Or8g30 C T 9: 39,230,815 (GRCm39) V32I probably benign Het
Or9q1 A G 19: 13,804,914 (GRCm39) I282T probably benign Het
Osbpl6 T G 2: 76,385,361 (GRCm39) L265R probably damaging Het
Pld4 A G 12: 112,734,862 (GRCm39) T440A probably damaging Het
Prr14 T C 7: 127,071,128 (GRCm39) M1T probably null Het
Ptger4 A T 15: 5,273,178 (GRCm39) M1K probably null Het
Ptpn22 A T 3: 103,795,842 (GRCm39) T608S possibly damaging Het
S1pr2 A G 9: 20,879,319 (GRCm39) W170R probably damaging Het
Specc1l A G 10: 75,066,603 (GRCm39) I17M probably benign Het
Spmap1 T A 11: 97,666,594 (GRCm39) I31F probably benign Het
Sptbn4 C G 7: 27,071,662 (GRCm39) G1601R probably damaging Het
Sqor C T 2: 122,626,912 (GRCm39) P11L probably benign Het
Stac2 T C 11: 97,934,449 (GRCm39) D85G probably benign Het
Svs5 G A 2: 164,078,918 (GRCm39) Q330* probably null Het
Taar7e A G 10: 23,913,554 (GRCm39) I15V probably benign Het
Tcf4 A T 18: 69,770,007 (GRCm39) Y275F probably damaging Het
Tenm4 A G 7: 96,538,046 (GRCm39) N1873S probably damaging Het
Tert T A 13: 73,775,648 (GRCm39) V133D probably benign Het
Tfap2a T A 13: 40,870,658 (GRCm39) N410I probably damaging Het
Tjp3 A T 10: 81,109,694 (GRCm39) D836E probably benign Het
Tox3 A T 8: 90,975,206 (GRCm39) M475K unknown Het
Traf4 A T 11: 78,050,979 (GRCm39) D392E probably damaging Het
Vav2 A G 2: 27,181,825 (GRCm39) L338P probably damaging Het
Vmn1r81 T C 7: 11,994,113 (GRCm39) N165S probably benign Het
Vmn2r9 A T 5: 108,995,409 (GRCm39) V413E probably damaging Het
Wdr7 A T 18: 63,911,059 (GRCm39) D817V probably damaging Het
Zbtb38 G A 9: 96,570,700 (GRCm39) S128L probably damaging Het
Zfhx4 T A 3: 5,464,922 (GRCm39) H1718Q probably damaging Het
Zfp945 G A 17: 23,071,228 (GRCm39) H245Y probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAACCATCTGGAGGAAGGCTG -3'
(R):5'- CATTTGCACTCTTTGGCTGG -3'

Sequencing Primer
(F):5'- ACCATCTGGAGGAAGGCTGATTTG -3'
(R):5'- GCTGGCAGCACCTAGTG -3'
Posted On 2022-11-14