Incidental Mutation 'R9790:Myh3'
ID 735897
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Name myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms Myhse, Myhs-e, MyHC-emb
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R9790 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67078300-67102291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67101179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1850 (E1850G)
Ref Sequence ENSEMBL: ENSMUSP00000007301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
AlphaFold P13541
Predicted Effect probably damaging
Transcript: ENSMUST00000007301
AA Change: E1850G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: E1850G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108689
AA Change: E1850G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: E1850G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165221
AA Change: E1850G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: E1850G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik T A 11: 97,775,768 I31F probably benign Het
Abcb1a T C 5: 8,698,604 Y312H probably damaging Het
Abcc10 A T 17: 46,322,259 I549N probably damaging Het
Agpat2 A G 2: 26,596,383 Y134H probably damaging Het
Alms1 A G 6: 85,619,443 D417G probably benign Het
Apol11b T A 15: 77,635,275 I202F probably benign Het
Arap1 C A 7: 101,388,169 Q468K probably benign Het
Arhgef4 T C 1: 34,793,364 probably null Het
Asap3 A T 4: 136,234,603 N285I probably damaging Het
Aspm A T 1: 139,480,637 I2421F probably damaging Het
Banp C A 8: 121,974,546 D17E probably benign Het
Bsx T G 9: 40,877,609 V154G probably damaging Het
Cacnb1 T C 11: 98,009,360 D324G probably damaging Het
Ccdc170 A T 10: 4,533,957 probably null Het
Ccdc187 T C 2: 26,281,215 H417R probably benign Het
Cct4 T A 11: 22,999,070 M272K probably damaging Het
Chd9 A G 8: 91,033,789 E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,028 H1504L probably benign Het
Cyp4a29 T A 4: 115,251,183 M368K probably damaging Het
Dhx32 A G 7: 133,724,538 F527L probably benign Het
Foxk1 T C 5: 142,401,984 V154A probably damaging Het
Frem3 G A 8: 80,613,261 E728K probably benign Het
Garem2 C A 5: 30,114,749 A403E probably benign Het
Gemin5 G A 11: 58,130,020 Q1114* probably null Het
Gm11567 C T 11: 99,879,448 R71C unknown Het
Gm13272 T C 4: 88,780,205 V119A probably benign Het
Gpc6 T A 14: 116,926,023 C30S probably damaging Het
Gprc6a A C 10: 51,615,299 F785V probably damaging Het
Hormad1 T C 3: 95,587,382 V368A probably benign Het
Hsd17b4 G A 18: 50,191,840 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il17ra C T 6: 120,482,279 S797F probably damaging Het
Jmjd6 A G 11: 116,842,612 S80P probably benign Het
Klhdc2 T A 12: 69,300,221 N53K probably benign Het
Klhl30 C T 1: 91,354,367 P230L probably benign Het
March1 C A 8: 66,276,687 A46E probably benign Het
Mast4 T C 13: 102,754,197 T1050A probably benign Het
Mpp7 T C 18: 7,355,049 N459S probably benign Het
Mtfr1l A G 4: 134,530,752 V53A probably benign Het
Myh11 T A 16: 14,208,128 E1326V Het
Myo16 A G 8: 10,569,925 D1492G unknown Het
Myo3b C A 2: 70,349,943 H1219Q probably benign Het
Nphp4 A T 4: 152,562,148 Q1379L probably null Het
Olfr1500 A G 19: 13,827,550 I282T probably benign Het
Olfr948 C T 9: 39,319,519 V32I probably benign Het
Osbpl6 T G 2: 76,555,017 L265R probably damaging Het
Pld4 A G 12: 112,768,428 T440A probably damaging Het
Prr14 T C 7: 127,471,956 M1T probably null Het
Ptger4 A T 15: 5,243,697 M1K probably null Het
Ptpn22 A T 3: 103,888,526 T608S possibly damaging Het
S1pr2 A G 9: 20,968,023 W170R probably damaging Het
Specc1l A G 10: 75,230,769 I17M probably benign Het
Sptbn4 C G 7: 27,372,237 G1601R probably damaging Het
Sqor C T 2: 122,784,992 P11L probably benign Het
Stac2 T C 11: 98,043,623 D85G probably benign Het
Svs2 G A 2: 164,236,998 Q330* probably null Het
Taar7e A G 10: 24,037,656 I15V probably benign Het
Tcf4 A T 18: 69,636,936 Y275F probably damaging Het
Tenm4 A G 7: 96,888,839 N1873S probably damaging Het
Tert T A 13: 73,627,529 V133D probably benign Het
Tfap2a T A 13: 40,717,182 N410I probably damaging Het
Tjp3 A T 10: 81,273,860 D836E probably benign Het
Tox3 A T 8: 90,248,578 M475K unknown Het
Traf4 A T 11: 78,160,153 D392E probably damaging Het
Vav2 A G 2: 27,291,813 L338P probably damaging Het
Vmn1r81 T C 7: 12,260,186 N165S probably benign Het
Vmn2r9 A T 5: 108,847,543 V413E probably damaging Het
Wdr7 A T 18: 63,777,988 D817V probably damaging Het
Zbtb38 G A 9: 96,688,647 S128L probably damaging Het
Zfhx4 T A 3: 5,399,862 H1718Q probably damaging Het
Zfp945 G A 17: 22,852,254 H245Y probably benign Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
R9103:Myh3 UTSW 11 67098625 missense probably benign 0.01
R9249:Myh3 UTSW 11 67085029 missense probably benign 0.12
R9307:Myh3 UTSW 11 67093571 missense possibly damaging 0.57
R9430:Myh3 UTSW 11 67091900 missense possibly damaging 0.94
R9529:Myh3 UTSW 11 67088730 critical splice donor site probably null
R9558:Myh3 UTSW 11 67092490 missense possibly damaging 0.89
R9565:Myh3 UTSW 11 67092361 nonsense probably null
R9691:Myh3 UTSW 11 67101095 missense possibly damaging 0.94
R9791:Myh3 UTSW 11 67101179 missense probably damaging 0.99
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAACTGGAGACACGGGTACC -3'
(R):5'- TTATCCACCAGATCCTGCAATC -3'

Sequencing Primer
(F):5'- CTGGAGACACGGGTACCTGATG -3'
(R):5'- CCCATTCCAAGCTTTGAG -3'
Posted On 2022-11-14