Incidental Mutation 'R9790:Myh3'
ID 735897
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Name myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms Myhse, Myhs-e, MyHC-emb
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.593) question?
Stock # R9790 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 66969126-66993117 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66992005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1850 (E1850G)
Ref Sequence ENSEMBL: ENSMUSP00000007301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
AlphaFold P13541
Predicted Effect probably damaging
Transcript: ENSMUST00000007301
AA Change: E1850G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: E1850G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108689
AA Change: E1850G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: E1850G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165221
AA Change: E1850G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: E1850G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,748,604 (GRCm39) Y312H probably damaging Het
Abcc10 A T 17: 46,633,185 (GRCm39) I549N probably damaging Het
Agpat2 A G 2: 26,486,395 (GRCm39) Y134H probably damaging Het
Alms1 A G 6: 85,596,425 (GRCm39) D417G probably benign Het
Apol11b T A 15: 77,519,475 (GRCm39) I202F probably benign Het
Arap1 C A 7: 101,037,376 (GRCm39) Q468K probably benign Het
Arhgef4 T C 1: 34,832,445 (GRCm39) probably null Het
Asap3 A T 4: 135,961,914 (GRCm39) N285I probably damaging Het
Aspm A T 1: 139,408,375 (GRCm39) I2421F probably damaging Het
Banp C A 8: 122,701,285 (GRCm39) D17E probably benign Het
Bsx T G 9: 40,788,905 (GRCm39) V154G probably damaging Het
Cacnb1 T C 11: 97,900,186 (GRCm39) D324G probably damaging Het
Ccdc170 A T 10: 4,483,957 (GRCm39) probably null Het
Ccdc187 T C 2: 26,171,227 (GRCm39) H417R probably benign Het
Cct4 T A 11: 22,949,070 (GRCm39) M272K probably damaging Het
Chd9 A G 8: 91,760,417 (GRCm39) E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 (GRCm39) S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,027 (GRCm39) H1504L probably benign Het
Cyp4a29 T A 4: 115,108,380 (GRCm39) M368K probably damaging Het
Dhx32 A G 7: 133,326,267 (GRCm39) F527L probably benign Het
Foxk1 T C 5: 142,387,739 (GRCm39) V154A probably damaging Het
Frem3 G A 8: 81,339,890 (GRCm39) E728K probably benign Het
Garem2 C A 5: 30,319,747 (GRCm39) A403E probably benign Het
Gemin5 G A 11: 58,020,846 (GRCm39) Q1114* probably null Het
Gm11567 C T 11: 99,770,274 (GRCm39) R71C unknown Het
Gm13272 T C 4: 88,698,442 (GRCm39) V119A probably benign Het
Gpc6 T A 14: 117,163,435 (GRCm39) C30S probably damaging Het
Gprc6a A C 10: 51,491,395 (GRCm39) F785V probably damaging Het
Hormad1 T C 3: 95,494,693 (GRCm39) V368A probably benign Het
Hsd17b4 G A 18: 50,324,907 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il17ra C T 6: 120,459,240 (GRCm39) S797F probably damaging Het
Jmjd6 A G 11: 116,733,438 (GRCm39) S80P probably benign Het
Klhdc2 T A 12: 69,346,995 (GRCm39) N53K probably benign Het
Klhl30 C T 1: 91,282,089 (GRCm39) P230L probably benign Het
Marchf1 C A 8: 66,729,339 (GRCm39) A46E probably benign Het
Mast4 T C 13: 102,890,705 (GRCm39) T1050A probably benign Het
Mpp7 T C 18: 7,355,049 (GRCm39) N459S probably benign Het
Mtfr1l A G 4: 134,258,063 (GRCm39) V53A probably benign Het
Myh11 T A 16: 14,025,992 (GRCm39) E1326V Het
Myo16 A G 8: 10,619,925 (GRCm39) D1492G unknown Het
Myo3b C A 2: 70,180,287 (GRCm39) H1219Q probably benign Het
Nphp4 A T 4: 152,646,605 (GRCm39) Q1379L probably null Het
Or8g30 C T 9: 39,230,815 (GRCm39) V32I probably benign Het
Or9q1 A G 19: 13,804,914 (GRCm39) I282T probably benign Het
Osbpl6 T G 2: 76,385,361 (GRCm39) L265R probably damaging Het
Pld4 A G 12: 112,734,862 (GRCm39) T440A probably damaging Het
Prr14 T C 7: 127,071,128 (GRCm39) M1T probably null Het
Ptger4 A T 15: 5,273,178 (GRCm39) M1K probably null Het
Ptpn22 A T 3: 103,795,842 (GRCm39) T608S possibly damaging Het
S1pr2 A G 9: 20,879,319 (GRCm39) W170R probably damaging Het
Specc1l A G 10: 75,066,603 (GRCm39) I17M probably benign Het
Spmap1 T A 11: 97,666,594 (GRCm39) I31F probably benign Het
Sptbn4 C G 7: 27,071,662 (GRCm39) G1601R probably damaging Het
Sqor C T 2: 122,626,912 (GRCm39) P11L probably benign Het
Stac2 T C 11: 97,934,449 (GRCm39) D85G probably benign Het
Svs5 G A 2: 164,078,918 (GRCm39) Q330* probably null Het
Taar7e A G 10: 23,913,554 (GRCm39) I15V probably benign Het
Tcf4 A T 18: 69,770,007 (GRCm39) Y275F probably damaging Het
Tenm4 A G 7: 96,538,046 (GRCm39) N1873S probably damaging Het
Tert T A 13: 73,775,648 (GRCm39) V133D probably benign Het
Tfap2a T A 13: 40,870,658 (GRCm39) N410I probably damaging Het
Tjp3 A T 10: 81,109,694 (GRCm39) D836E probably benign Het
Tox3 A T 8: 90,975,206 (GRCm39) M475K unknown Het
Traf4 A T 11: 78,050,979 (GRCm39) D392E probably damaging Het
Vav2 A G 2: 27,181,825 (GRCm39) L338P probably damaging Het
Vmn1r81 T C 7: 11,994,113 (GRCm39) N165S probably benign Het
Vmn2r9 A T 5: 108,995,409 (GRCm39) V413E probably damaging Het
Wdr7 A T 18: 63,911,059 (GRCm39) D817V probably damaging Het
Zbtb38 G A 9: 96,570,700 (GRCm39) S128L probably damaging Het
Zfhx4 T A 3: 5,464,922 (GRCm39) H1718Q probably damaging Het
Zfp945 G A 17: 23,071,228 (GRCm39) H245Y probably benign Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 66,981,681 (GRCm39) missense probably damaging 1.00
IGL01989:Myh3 APN 11 66,977,481 (GRCm39) missense probably damaging 1.00
IGL02097:Myh3 APN 11 66,973,750 (GRCm39) missense probably benign
IGL02197:Myh3 APN 11 66,989,409 (GRCm39) missense probably benign 0.05
IGL02458:Myh3 APN 11 66,987,766 (GRCm39) missense possibly damaging 0.87
IGL02526:Myh3 APN 11 66,978,371 (GRCm39) missense probably benign 0.01
IGL02559:Myh3 APN 11 66,991,921 (GRCm39) missense possibly damaging 0.94
IGL02600:Myh3 APN 11 66,974,227 (GRCm39) missense probably damaging 1.00
IGL02866:Myh3 APN 11 66,979,849 (GRCm39) missense probably benign 0.08
IGL02943:Myh3 APN 11 66,981,891 (GRCm39) missense probably benign 0.02
IGL03087:Myh3 APN 11 66,981,798 (GRCm39) missense probably damaging 1.00
IGL03131:Myh3 APN 11 66,981,935 (GRCm39) splice site probably benign
bud UTSW 11 66,986,833 (GRCm39) critical splice acceptor site probably null
R0049:Myh3 UTSW 11 66,990,498 (GRCm39) missense probably damaging 1.00
R0157:Myh3 UTSW 11 66,973,735 (GRCm39) missense probably benign 0.00
R0266:Myh3 UTSW 11 66,984,498 (GRCm39) missense possibly damaging 0.73
R0352:Myh3 UTSW 11 66,981,254 (GRCm39) missense possibly damaging 0.79
R0391:Myh3 UTSW 11 66,987,333 (GRCm39) splice site probably benign
R0926:Myh3 UTSW 11 66,981,340 (GRCm39) splice site probably null
R1243:Myh3 UTSW 11 66,981,279 (GRCm39) missense possibly damaging 0.80
R1344:Myh3 UTSW 11 66,983,158 (GRCm39) missense probably benign 0.03
R1414:Myh3 UTSW 11 66,989,491 (GRCm39) missense probably damaging 0.98
R1442:Myh3 UTSW 11 66,978,103 (GRCm39) missense possibly damaging 0.77
R1470:Myh3 UTSW 11 66,988,885 (GRCm39) splice site probably benign
R1480:Myh3 UTSW 11 66,984,371 (GRCm39) missense possibly damaging 0.88
R1598:Myh3 UTSW 11 66,983,997 (GRCm39) missense probably damaging 1.00
R1620:Myh3 UTSW 11 66,979,562 (GRCm39) splice site probably benign
R1682:Myh3 UTSW 11 66,979,891 (GRCm39) missense probably damaging 1.00
R1759:Myh3 UTSW 11 66,987,717 (GRCm39) missense probably damaging 0.98
R1772:Myh3 UTSW 11 66,990,220 (GRCm39) missense probably benign 0.32
R1868:Myh3 UTSW 11 66,975,852 (GRCm39) missense probably benign 0.34
R1874:Myh3 UTSW 11 66,984,005 (GRCm39) missense probably benign 0.03
R1885:Myh3 UTSW 11 66,977,453 (GRCm39) missense probably benign 0.23
R1923:Myh3 UTSW 11 66,970,828 (GRCm39) missense probably benign 0.00
R2145:Myh3 UTSW 11 66,981,882 (GRCm39) missense probably benign
R3973:Myh3 UTSW 11 66,987,262 (GRCm39) nonsense probably null
R4410:Myh3 UTSW 11 66,975,858 (GRCm39) missense possibly damaging 0.71
R4583:Myh3 UTSW 11 66,987,279 (GRCm39) nonsense probably null
R4650:Myh3 UTSW 11 66,977,270 (GRCm39) missense probably damaging 1.00
R4822:Myh3 UTSW 11 66,979,836 (GRCm39) missense probably benign
R4836:Myh3 UTSW 11 66,987,765 (GRCm39) missense probably benign 0.01
R4898:Myh3 UTSW 11 66,990,233 (GRCm39) missense probably benign 0.05
R4946:Myh3 UTSW 11 66,984,364 (GRCm39) missense probably benign
R5506:Myh3 UTSW 11 66,974,915 (GRCm39) missense probably damaging 1.00
R5534:Myh3 UTSW 11 66,987,870 (GRCm39) missense probably damaging 1.00
R5733:Myh3 UTSW 11 66,979,445 (GRCm39) missense probably benign 0.24
R5889:Myh3 UTSW 11 66,977,201 (GRCm39) missense probably damaging 1.00
R6056:Myh3 UTSW 11 66,978,371 (GRCm39) missense probably benign 0.01
R6223:Myh3 UTSW 11 66,988,843 (GRCm39) missense probably benign
R6228:Myh3 UTSW 11 66,978,312 (GRCm39) missense probably benign 0.17
R6341:Myh3 UTSW 11 66,973,822 (GRCm39) missense probably benign 0.00
R6434:Myh3 UTSW 11 66,973,193 (GRCm39) missense probably damaging 1.00
R6533:Myh3 UTSW 11 66,981,245 (GRCm39) missense probably damaging 0.96
R6812:Myh3 UTSW 11 66,977,228 (GRCm39) missense probably damaging 0.99
R7336:Myh3 UTSW 11 66,981,847 (GRCm39) missense probably benign 0.13
R7354:Myh3 UTSW 11 66,987,708 (GRCm39) missense probably damaging 1.00
R7498:Myh3 UTSW 11 66,987,874 (GRCm39) missense possibly damaging 0.96
R7532:Myh3 UTSW 11 66,981,921 (GRCm39) missense probably benign
R7841:Myh3 UTSW 11 66,989,518 (GRCm39) missense probably damaging 1.00
R7878:Myh3 UTSW 11 66,978,077 (GRCm39) missense probably damaging 1.00
R8169:Myh3 UTSW 11 66,979,856 (GRCm39) missense probably benign 0.06
R8194:Myh3 UTSW 11 66,982,828 (GRCm39) missense probably damaging 1.00
R8215:Myh3 UTSW 11 66,992,005 (GRCm39) missense probably damaging 0.99
R8240:Myh3 UTSW 11 66,983,196 (GRCm39) missense probably benign 0.01
R8255:Myh3 UTSW 11 66,985,848 (GRCm39) missense probably damaging 1.00
R8310:Myh3 UTSW 11 66,986,833 (GRCm39) critical splice acceptor site probably null
R9103:Myh3 UTSW 11 66,989,451 (GRCm39) missense probably benign 0.01
R9249:Myh3 UTSW 11 66,975,855 (GRCm39) missense probably benign 0.12
R9307:Myh3 UTSW 11 66,984,397 (GRCm39) missense possibly damaging 0.57
R9430:Myh3 UTSW 11 66,982,726 (GRCm39) missense possibly damaging 0.94
R9529:Myh3 UTSW 11 66,979,556 (GRCm39) critical splice donor site probably null
R9558:Myh3 UTSW 11 66,983,316 (GRCm39) missense possibly damaging 0.89
R9565:Myh3 UTSW 11 66,983,187 (GRCm39) nonsense probably null
R9691:Myh3 UTSW 11 66,991,921 (GRCm39) missense possibly damaging 0.94
R9791:Myh3 UTSW 11 66,992,005 (GRCm39) missense probably damaging 0.99
RF009:Myh3 UTSW 11 66,977,183 (GRCm39) frame shift probably null
RF009:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
RF009:Myh3 UTSW 11 66,977,181 (GRCm39) frame shift probably null
RF010:Myh3 UTSW 11 66,977,185 (GRCm39) frame shift probably null
RF010:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
RF013:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
RF015:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
X0060:Myh3 UTSW 11 66,985,824 (GRCm39) missense probably benign 0.00
X0062:Myh3 UTSW 11 66,979,942 (GRCm39) missense probably benign 0.03
Z1176:Myh3 UTSW 11 66,973,241 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAACTGGAGACACGGGTACC -3'
(R):5'- TTATCCACCAGATCCTGCAATC -3'

Sequencing Primer
(F):5'- CTGGAGACACGGGTACCTGATG -3'
(R):5'- CCCATTCCAAGCTTTGAG -3'
Posted On 2022-11-14