Incidental Mutation 'R9790:Zfp945'
ID 735913
Institutional Source Beutler Lab
Gene Symbol Zfp945
Ensembl Gene ENSMUSG00000059142
Gene Name zinc finger protein 945
Synonyms C730040L01Rik, A630033E08Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9790 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23065671-23086108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 23071228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 245 (H245Y)
Ref Sequence ENSEMBL: ENSMUSP00000124123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088696] [ENSMUST00000150092] [ENSMUST00000160457]
AlphaFold F6WAU7
Predicted Effect probably benign
Transcript: ENSMUST00000088696
AA Change: H224Y

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000086074
Gene: ENSMUSG00000059142
AA Change: H224Y

DomainStartEndE-ValueType
KRAB 13 68 9.12e-18 SMART
ZnF_C2H2 210 232 1.45e-2 SMART
ZnF_C2H2 238 260 1.03e-2 SMART
ZnF_C2H2 266 288 1.76e-1 SMART
ZnF_C2H2 322 344 7.37e-4 SMART
ZnF_C2H2 350 372 1.5e-4 SMART
ZnF_C2H2 378 400 5.14e-3 SMART
ZnF_C2H2 406 428 9.73e-4 SMART
ZnF_C2H2 434 456 2.99e-4 SMART
ZnF_C2H2 462 484 4.54e-4 SMART
ZnF_C2H2 490 512 2.4e-3 SMART
ZnF_C2H2 518 540 1.38e-3 SMART
ZnF_C2H2 546 568 1.13e-4 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 9.31e1 SMART
ZnF_C2H2 630 652 7.9e-4 SMART
ZnF_C2H2 658 680 3.69e-4 SMART
ZnF_C2H2 686 708 3.16e-3 SMART
ZnF_C2H2 714 736 2.95e-3 SMART
ZnF_C2H2 742 764 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150092
SMART Domains Protein: ENSMUSP00000117978
Gene: ENSMUSG00000059142

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160457
AA Change: H245Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124123
Gene: ENSMUSG00000059142
AA Change: H245Y

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
ZnF_C2H2 231 253 1.45e-2 SMART
ZnF_C2H2 259 281 1.03e-2 SMART
ZnF_C2H2 287 309 1.76e-1 SMART
ZnF_C2H2 343 365 7.37e-4 SMART
ZnF_C2H2 371 393 1.5e-4 SMART
ZnF_C2H2 399 421 5.14e-3 SMART
ZnF_C2H2 427 449 9.73e-4 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 4.54e-4 SMART
ZnF_C2H2 511 533 2.4e-3 SMART
ZnF_C2H2 539 561 1.38e-3 SMART
ZnF_C2H2 567 589 1.13e-4 SMART
ZnF_C2H2 595 617 5.59e-4 SMART
ZnF_C2H2 623 645 9.31e1 SMART
ZnF_C2H2 651 673 7.9e-4 SMART
ZnF_C2H2 679 701 3.69e-4 SMART
ZnF_C2H2 707 729 3.16e-3 SMART
ZnF_C2H2 735 757 2.95e-3 SMART
ZnF_C2H2 763 785 1.98e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,748,604 (GRCm39) Y312H probably damaging Het
Abcc10 A T 17: 46,633,185 (GRCm39) I549N probably damaging Het
Agpat2 A G 2: 26,486,395 (GRCm39) Y134H probably damaging Het
Alms1 A G 6: 85,596,425 (GRCm39) D417G probably benign Het
Apol11b T A 15: 77,519,475 (GRCm39) I202F probably benign Het
Arap1 C A 7: 101,037,376 (GRCm39) Q468K probably benign Het
Arhgef4 T C 1: 34,832,445 (GRCm39) probably null Het
Asap3 A T 4: 135,961,914 (GRCm39) N285I probably damaging Het
Aspm A T 1: 139,408,375 (GRCm39) I2421F probably damaging Het
Banp C A 8: 122,701,285 (GRCm39) D17E probably benign Het
Bsx T G 9: 40,788,905 (GRCm39) V154G probably damaging Het
Cacnb1 T C 11: 97,900,186 (GRCm39) D324G probably damaging Het
Ccdc170 A T 10: 4,483,957 (GRCm39) probably null Het
Ccdc187 T C 2: 26,171,227 (GRCm39) H417R probably benign Het
Cct4 T A 11: 22,949,070 (GRCm39) M272K probably damaging Het
Chd9 A G 8: 91,760,417 (GRCm39) E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 (GRCm39) S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,027 (GRCm39) H1504L probably benign Het
Cyp4a29 T A 4: 115,108,380 (GRCm39) M368K probably damaging Het
Dhx32 A G 7: 133,326,267 (GRCm39) F527L probably benign Het
Foxk1 T C 5: 142,387,739 (GRCm39) V154A probably damaging Het
Frem3 G A 8: 81,339,890 (GRCm39) E728K probably benign Het
Garem2 C A 5: 30,319,747 (GRCm39) A403E probably benign Het
Gemin5 G A 11: 58,020,846 (GRCm39) Q1114* probably null Het
Gm11567 C T 11: 99,770,274 (GRCm39) R71C unknown Het
Gm13272 T C 4: 88,698,442 (GRCm39) V119A probably benign Het
Gpc6 T A 14: 117,163,435 (GRCm39) C30S probably damaging Het
Gprc6a A C 10: 51,491,395 (GRCm39) F785V probably damaging Het
Hormad1 T C 3: 95,494,693 (GRCm39) V368A probably benign Het
Hsd17b4 G A 18: 50,324,907 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il17ra C T 6: 120,459,240 (GRCm39) S797F probably damaging Het
Jmjd6 A G 11: 116,733,438 (GRCm39) S80P probably benign Het
Klhdc2 T A 12: 69,346,995 (GRCm39) N53K probably benign Het
Klhl30 C T 1: 91,282,089 (GRCm39) P230L probably benign Het
Marchf1 C A 8: 66,729,339 (GRCm39) A46E probably benign Het
Mast4 T C 13: 102,890,705 (GRCm39) T1050A probably benign Het
Mpp7 T C 18: 7,355,049 (GRCm39) N459S probably benign Het
Mtfr1l A G 4: 134,258,063 (GRCm39) V53A probably benign Het
Myh11 T A 16: 14,025,992 (GRCm39) E1326V Het
Myh3 A G 11: 66,992,005 (GRCm39) E1850G probably damaging Het
Myo16 A G 8: 10,619,925 (GRCm39) D1492G unknown Het
Myo3b C A 2: 70,180,287 (GRCm39) H1219Q probably benign Het
Nphp4 A T 4: 152,646,605 (GRCm39) Q1379L probably null Het
Or8g30 C T 9: 39,230,815 (GRCm39) V32I probably benign Het
Or9q1 A G 19: 13,804,914 (GRCm39) I282T probably benign Het
Osbpl6 T G 2: 76,385,361 (GRCm39) L265R probably damaging Het
Pld4 A G 12: 112,734,862 (GRCm39) T440A probably damaging Het
Prr14 T C 7: 127,071,128 (GRCm39) M1T probably null Het
Ptger4 A T 15: 5,273,178 (GRCm39) M1K probably null Het
Ptpn22 A T 3: 103,795,842 (GRCm39) T608S possibly damaging Het
S1pr2 A G 9: 20,879,319 (GRCm39) W170R probably damaging Het
Specc1l A G 10: 75,066,603 (GRCm39) I17M probably benign Het
Spmap1 T A 11: 97,666,594 (GRCm39) I31F probably benign Het
Sptbn4 C G 7: 27,071,662 (GRCm39) G1601R probably damaging Het
Sqor C T 2: 122,626,912 (GRCm39) P11L probably benign Het
Stac2 T C 11: 97,934,449 (GRCm39) D85G probably benign Het
Svs5 G A 2: 164,078,918 (GRCm39) Q330* probably null Het
Taar7e A G 10: 23,913,554 (GRCm39) I15V probably benign Het
Tcf4 A T 18: 69,770,007 (GRCm39) Y275F probably damaging Het
Tenm4 A G 7: 96,538,046 (GRCm39) N1873S probably damaging Het
Tert T A 13: 73,775,648 (GRCm39) V133D probably benign Het
Tfap2a T A 13: 40,870,658 (GRCm39) N410I probably damaging Het
Tjp3 A T 10: 81,109,694 (GRCm39) D836E probably benign Het
Tox3 A T 8: 90,975,206 (GRCm39) M475K unknown Het
Traf4 A T 11: 78,050,979 (GRCm39) D392E probably damaging Het
Vav2 A G 2: 27,181,825 (GRCm39) L338P probably damaging Het
Vmn1r81 T C 7: 11,994,113 (GRCm39) N165S probably benign Het
Vmn2r9 A T 5: 108,995,409 (GRCm39) V413E probably damaging Het
Wdr7 A T 18: 63,911,059 (GRCm39) D817V probably damaging Het
Zbtb38 G A 9: 96,570,700 (GRCm39) S128L probably damaging Het
Zfhx4 T A 3: 5,464,922 (GRCm39) H1718Q probably damaging Het
Other mutations in Zfp945
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Zfp945 APN 17 23,070,931 (GRCm39) unclassified probably benign
IGL01077:Zfp945 APN 17 23,071,359 (GRCm39) missense probably damaging 0.99
IGL02706:Zfp945 APN 17 23,076,256 (GRCm39) missense probably damaging 1.00
IGL03408:Zfp945 APN 17 23,071,511 (GRCm39) nonsense probably null
Small-scale UTSW 17 23,069,955 (GRCm39) missense probably damaging 1.00
R0427:Zfp945 UTSW 17 23,084,226 (GRCm39) missense probably benign 0.10
R0718:Zfp945 UTSW 17 23,070,004 (GRCm39) missense probably damaging 1.00
R1305:Zfp945 UTSW 17 23,071,360 (GRCm39) missense probably damaging 0.97
R1801:Zfp945 UTSW 17 23,070,736 (GRCm39) missense probably damaging 0.97
R1837:Zfp945 UTSW 17 23,070,247 (GRCm39) missense probably damaging 1.00
R2001:Zfp945 UTSW 17 23,076,223 (GRCm39) critical splice donor site probably null
R4193:Zfp945 UTSW 17 23,070,144 (GRCm39) unclassified probably benign
R4247:Zfp945 UTSW 17 23,069,583 (GRCm39) missense probably damaging 0.98
R5026:Zfp945 UTSW 17 23,069,859 (GRCm39) missense probably damaging 1.00
R5918:Zfp945 UTSW 17 23,069,955 (GRCm39) missense probably damaging 1.00
R6076:Zfp945 UTSW 17 23,070,432 (GRCm39) missense probably damaging 1.00
R6664:Zfp945 UTSW 17 23,071,339 (GRCm39) missense probably damaging 0.99
R6997:Zfp945 UTSW 17 23,071,543 (GRCm39) nonsense probably null
R7040:Zfp945 UTSW 17 23,071,264 (GRCm39) missense probably damaging 0.98
R7479:Zfp945 UTSW 17 23,070,340 (GRCm39) missense possibly damaging 0.93
R7566:Zfp945 UTSW 17 23,070,727 (GRCm39) missense possibly damaging 0.71
R7948:Zfp945 UTSW 17 23,071,096 (GRCm39) missense unknown
R8383:Zfp945 UTSW 17 23,070,798 (GRCm39) missense probably benign 0.05
R9776:Zfp945 UTSW 17 23,070,582 (GRCm39) missense possibly damaging 0.93
R9791:Zfp945 UTSW 17 23,071,228 (GRCm39) missense probably benign 0.33
X0063:Zfp945 UTSW 17 23,071,202 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTAATGGCATTCACGGTAGG -3'
(R):5'- CACTGTATGATGAAGCTTTTCTCTC -3'

Sequencing Primer
(F):5'- GATGTTTTCTAAGACCTGAGCAGCAG -3'
(R):5'- CACAAGTGCAGGAAGTCT -3'
Posted On 2022-11-14