Mutagenetix > Incidental Mutation

Incidental Mutation 'R9694:Sall2'

735980

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9694 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 52314667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 357 (G357D)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058326
AA Change: G357D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: G357D

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: G355D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,849,573	Y948N	probably damaging	Het
Adamts2	A	G	11: 50,668,145	D229G	probably benign	Het
Adamts4	T	C	1: 171,253,961	S395P	probably benign	Het
Adcy1	T	C	11: 7,144,774	Y567H	probably damaging	Het
Agap3	A	G	5: 24,477,141	N212D	probably benign	Het
Atp2a2	A	G	5: 122,459,645	F775S	probably damaging	Het
Baz1b	A	T	5: 135,244,240	Q1406L	probably benign	Het
C030006K11Rik	A	T	15: 76,723,728	V30D	possibly damaging	Het
Ccdc144b	A	G	3: 36,018,943	S397P	possibly damaging	Het
Cep170b	T	A	12: 112,735,559	V262E	probably damaging	Het
Cgnl1	C	T	9: 71,725,521	G183R	probably benign	Het
Chd8	A	G	14: 52,203,884	I2257T	possibly damaging	Het
Chrna7	A	G	7: 63,105,061	I266T	probably damaging	Het
Cyp3a25	A	T	5: 145,986,875	Y319*	probably null	Het
Dcdc2a	A	T	13: 25,102,357	I125F	probably benign	Het
Dcdc2c	A	T	12: 28,535,554	I80N		Het
Dmtn	T	C	14: 70,615,292		probably null	Het
Dock2	T	C	11: 34,268,054	N1172S	probably benign	Het
Dock9	A	G	14: 121,581,379	S1564P	probably damaging	Het
Dusp27	A	T	1: 166,101,085	S319R	probably damaging	Het
Ecel1	T	C	1: 87,153,131	I350V	possibly damaging	Het
Eif4enif1	C	T	11: 3,220,384	L146F	probably damaging	Het
Ergic1	T	G	17: 26,624,611	D59E	probably benign	Het
F2rl2	A	T	13: 95,701,542	D365V	possibly damaging	Het
Fbxl16	C	T	17: 25,817,839	Q265*	probably null	Het
Fbxw26	T	C	9: 109,746,067		probably benign	Het
Fras1	A	T	5: 96,781,686	Y3983F	probably benign	Het
G6pd2	T	A	5: 61,809,117	D78E	probably benign	Het
Gas2l2	A	C	11: 83,423,344	S381A	possibly damaging	Het
Grk2	G	A	19: 4,288,483	R474C	probably damaging	Het
Gxylt2	T	A	6: 100,733,213	V105E	probably benign	Het
Hexdc	T	C	11: 121,216,987	V181A	probably damaging	Het
Ik	T	A	18: 36,744,787	D5E	probably benign	Het
Ilkap	A	G	1: 91,376,251	C163R		Het
Itpr3	C	T	17: 27,115,953	T2147I	probably damaging	Het
Kif1a	A	T	1: 93,022,451	V1418E	probably benign	Het
Kif26b	T	C	1: 178,916,250	C1304R	probably benign	Het
Lmna	CAGCACGGTGCGTGAGC	CAGC	3: 88,482,550		probably null	Het
Lvrn	A	T	18: 46,900,542	D940V	probably damaging	Het
Mill1	G	A	7: 18,263,102	R206H	probably benign	Het
Mrgpra1	A	T	7: 47,335,520	L137Q	probably damaging	Het
Npc2	C	A	12: 84,760,864	L73F	probably benign	Het
Olfr1042	T	C	2: 86,160,337	E11G	probably benign	Het
Olfr1052	T	C	2: 86,298,374	I186T	probably benign	Het
Olfr1447	A	T	19: 12,901,657	V41E	probably damaging	Het
Olfr556	A	T	7: 102,670,804	I295F	possibly damaging	Het
Olfr742	A	G	14: 50,515,212	T3A	probably benign	Het
Osbpl1a	T	C	18: 12,819,508	H533R	probably benign	Het
Pax7	G	A	4: 139,829,508	T147M	probably benign	Het
Pdik1l	A	T	4: 134,279,400	S143T	unknown	Het
Prkg1	T	G	19: 30,786,971	T255P	possibly damaging	Het
Prmt2	A	T	10: 76,225,379	I91N	probably damaging	Het
Ptprm	A	G	17: 66,809,489	Y932H	probably damaging	Het
Ptprz1	A	T	6: 22,959,695	I64F	probably damaging	Het
Qrich2	T	C	11: 116,447,120	K154R	probably damaging	Het
Rab8b	T	C	9: 66,919,542	D31G	probably benign	Het
Radil	A	G	5: 142,487,623	S768P	probably damaging	Het
Rbm5	A	T	9: 107,744,953	D607E	probably benign	Het
Reep6	T	A	10: 80,333,559	V131E	probably damaging	Het
Rrbp1	T	A	2: 143,990,179	I23F	probably damaging	Het
Rubcn	A	T	16: 32,843,111	V385D	probably benign	Het
Slc12a6	T	A	2: 112,344,536	L547H	probably damaging	Het
Slc16a6	T	C	11: 109,463,496	T100A	probably benign	Het
Sptbn2	T	C	19: 4,750,507	L2250P	probably damaging	Het
Stab1	C	T	14: 31,154,944	A808T	probably benign	Het
Stag1	A	G	9: 100,928,098	T785A	probably benign	Het
Stambpl1	T	G	19: 34,234,135	S199A	probably benign	Het
Supt20	C	T	3: 54,715,594	S496L	probably benign	Het
Tanc1	T	C	2: 59,795,852	F518L	probably damaging	Het
Tdpoz3	T	A	3: 93,826,849	V277D	probably benign	Het
Ttc30a2	T	C	2: 75,977,347	T274A	probably benign	Het
Unc45a	A	C	7: 80,325,655	Y934D	probably damaging	Het
Vmn1r192	G	A	13: 22,187,949	P34S	probably benign	Het
Wipf3	T	C	6: 54,489,019	S421P	possibly damaging	Het
Zfp296	A	G	7: 19,580,302	K361E	possibly damaging	Het
Zfp882	T	A	8: 71,914,071	N247K	probably benign	Het
Zfpm2	A	G	15: 41,102,314	T732A	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCCCGAGTTGTGAAAC -3'
(R):5'- TGGGATCACAGCATCCCTTCTC -3'

Sequencing Primer
(F):5'- CCGAGTTGTGAAACGGTTACCAC -3'
(R):5'- ACAGCATCCCTTCTCTGTAGGAG -3'

Posted On

2022-11-14