Incidental Mutation 'R9694:Dock9'
ID 735982
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9694 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121818791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1564 (S1564P)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: S1563P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: S1563P

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: S1534P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: S1534P

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: S1564P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: S1554P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,899,573 (GRCm39) Y948N probably damaging Het
Adamts2 A G 11: 50,558,972 (GRCm39) D229G probably benign Het
Adamts4 T C 1: 171,081,530 (GRCm39) S395P probably benign Het
Adcy1 T C 11: 7,094,774 (GRCm39) Y567H probably damaging Het
Agap3 A G 5: 24,682,139 (GRCm39) N212D probably benign Het
Atp2a2 A G 5: 122,597,708 (GRCm39) F775S probably damaging Het
Baz1b A T 5: 135,273,094 (GRCm39) Q1406L probably benign Het
C030006K11Rik A T 15: 76,607,928 (GRCm39) V30D possibly damaging Het
Cep170b T A 12: 112,701,993 (GRCm39) V262E probably damaging Het
Cgnl1 C T 9: 71,632,803 (GRCm39) G183R probably benign Het
Chd8 A G 14: 52,441,341 (GRCm39) I2257T possibly damaging Het
Chrna7 A G 7: 62,754,809 (GRCm39) I266T probably damaging Het
Cyp3a25 A T 5: 145,923,685 (GRCm39) Y319* probably null Het
Dcdc2a A T 13: 25,286,340 (GRCm39) I125F probably benign Het
Dcdc2c A T 12: 28,585,553 (GRCm39) I80N Het
Dmtn T C 14: 70,852,732 (GRCm39) probably null Het
Dock2 T C 11: 34,218,054 (GRCm39) N1172S probably benign Het
Ecel1 T C 1: 87,080,853 (GRCm39) I350V possibly damaging Het
Eif4enif1 C T 11: 3,170,384 (GRCm39) L146F probably damaging Het
Ergic1 T G 17: 26,843,585 (GRCm39) D59E probably benign Het
F2rl2 A T 13: 95,838,050 (GRCm39) D365V possibly damaging Het
Fbxl16 C T 17: 26,036,813 (GRCm39) Q265* probably null Het
Fbxw26 T C 9: 109,575,135 (GRCm39) probably benign Het
Fras1 A T 5: 96,929,545 (GRCm39) Y3983F probably benign Het
G6pd2 T A 5: 61,966,460 (GRCm39) D78E probably benign Het
Gas2l2 A C 11: 83,314,170 (GRCm39) S381A possibly damaging Het
Gm57858 A G 3: 36,073,092 (GRCm39) S397P possibly damaging Het
Grk2 G A 19: 4,338,511 (GRCm39) R474C probably damaging Het
Gxylt2 T A 6: 100,710,174 (GRCm39) V105E probably benign Het
Hexd T C 11: 121,107,813 (GRCm39) V181A probably damaging Het
Ift70a2 T C 2: 75,807,691 (GRCm39) T274A probably benign Het
Ik T A 18: 36,877,840 (GRCm39) D5E probably benign Het
Ilkap A G 1: 91,303,973 (GRCm39) C163R Het
Itpr3 C T 17: 27,334,927 (GRCm39) T2147I probably damaging Het
Kif1a A T 1: 92,950,173 (GRCm39) V1418E probably benign Het
Kif26b T C 1: 178,743,815 (GRCm39) C1304R probably benign Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,389,857 (GRCm39) probably null Het
Lvrn A T 18: 47,033,609 (GRCm39) D940V probably damaging Het
Mill1 G A 7: 17,997,027 (GRCm39) R206H probably benign Het
Mrgpra1 A T 7: 46,985,268 (GRCm39) L137Q probably damaging Het
Npc2 C A 12: 84,807,638 (GRCm39) L73F probably benign Het
Or11g26 A G 14: 50,752,669 (GRCm39) T3A probably benign Het
Or52i2 A T 7: 102,320,011 (GRCm39) I295F possibly damaging Het
Or5al1 T C 2: 85,990,681 (GRCm39) E11G probably benign Het
Or5b97 A T 19: 12,879,021 (GRCm39) V41E probably damaging Het
Or5j3 T C 2: 86,128,718 (GRCm39) I186T probably benign Het
Osbpl1a T C 18: 12,952,565 (GRCm39) H533R probably benign Het
Pax7 G A 4: 139,556,819 (GRCm39) T147M probably benign Het
Pdik1l A T 4: 134,006,711 (GRCm39) S143T unknown Het
Prkg1 T G 19: 30,764,371 (GRCm39) T255P possibly damaging Het
Prmt2 A T 10: 76,061,213 (GRCm39) I91N probably damaging Het
Ptprm A G 17: 67,116,484 (GRCm39) Y932H probably damaging Het
Ptprz1 A T 6: 22,959,694 (GRCm39) I64F probably damaging Het
Qrich2 T C 11: 116,337,946 (GRCm39) K154R probably damaging Het
Rab8b T C 9: 66,826,824 (GRCm39) D31G probably benign Het
Radil A G 5: 142,473,378 (GRCm39) S768P probably damaging Het
Rbm5 A T 9: 107,622,152 (GRCm39) D607E probably benign Het
Reep6 T A 10: 80,169,393 (GRCm39) V131E probably damaging Het
Rrbp1 T A 2: 143,832,099 (GRCm39) I23F probably damaging Het
Rubcn A T 16: 32,663,481 (GRCm39) V385D probably benign Het
Sall2 C T 14: 52,552,124 (GRCm39) G357D possibly damaging Het
Slc12a6 T A 2: 112,174,881 (GRCm39) L547H probably damaging Het
Slc16a6 T C 11: 109,354,322 (GRCm39) T100A probably benign Het
Sptbn2 T C 19: 4,800,535 (GRCm39) L2250P probably damaging Het
Stab1 C T 14: 30,876,901 (GRCm39) A808T probably benign Het
Stag1 A G 9: 100,810,151 (GRCm39) T785A probably benign Het
Stambpl1 T G 19: 34,211,535 (GRCm39) S199A probably benign Het
Styxl2 A T 1: 165,928,654 (GRCm39) S319R probably damaging Het
Supt20 C T 3: 54,623,015 (GRCm39) S496L probably benign Het
Tanc1 T C 2: 59,626,196 (GRCm39) F518L probably damaging Het
Tdpoz3 T A 3: 93,734,156 (GRCm39) V277D probably benign Het
Unc45a A C 7: 79,975,403 (GRCm39) Y934D probably damaging Het
Vmn1r192 G A 13: 22,372,119 (GRCm39) P34S probably benign Het
Wipf3 T C 6: 54,466,004 (GRCm39) S421P possibly damaging Het
Zfp296 A G 7: 19,314,227 (GRCm39) K361E possibly damaging Het
Zfp882 T A 8: 72,667,915 (GRCm39) N247K probably benign Het
Zfpm2 A G 15: 40,965,710 (GRCm39) T732A possibly damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGCCACCCACTAGACAG -3'
(R):5'- CCACACATCTTCCCTTGCAGAG -3'

Sequencing Primer
(F):5'- AGGACTTACGATGTTACCCCCTAG -3'
(R):5'- GCAGAGGCTTCATTCACATCC -3'
Posted On 2022-11-14