Incidental Mutation 'R9694:Dock9'
ID 735982
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9694 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121581379 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1564 (S1564P)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: S1563P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: S1563P

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: S1534P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: S1534P

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: S1564P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: S1554P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,849,573 Y948N probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adamts4 T C 1: 171,253,961 S395P probably benign Het
Adcy1 T C 11: 7,144,774 Y567H probably damaging Het
Agap3 A G 5: 24,477,141 N212D probably benign Het
Atp2a2 A G 5: 122,459,645 F775S probably damaging Het
Baz1b A T 5: 135,244,240 Q1406L probably benign Het
C030006K11Rik A T 15: 76,723,728 V30D possibly damaging Het
Ccdc144b A G 3: 36,018,943 S397P possibly damaging Het
Cep170b T A 12: 112,735,559 V262E probably damaging Het
Cgnl1 C T 9: 71,725,521 G183R probably benign Het
Chd8 A G 14: 52,203,884 I2257T possibly damaging Het
Chrna7 A G 7: 63,105,061 I266T probably damaging Het
Cyp3a25 A T 5: 145,986,875 Y319* probably null Het
Dcdc2a A T 13: 25,102,357 I125F probably benign Het
Dcdc2c A T 12: 28,535,554 I80N Het
Dmtn T C 14: 70,615,292 probably null Het
Dock2 T C 11: 34,268,054 N1172S probably benign Het
Dusp27 A T 1: 166,101,085 S319R probably damaging Het
Ecel1 T C 1: 87,153,131 I350V possibly damaging Het
Eif4enif1 C T 11: 3,220,384 L146F probably damaging Het
Ergic1 T G 17: 26,624,611 D59E probably benign Het
F2rl2 A T 13: 95,701,542 D365V possibly damaging Het
Fbxl16 C T 17: 25,817,839 Q265* probably null Het
Fbxw26 T C 9: 109,746,067 probably benign Het
Fras1 A T 5: 96,781,686 Y3983F probably benign Het
G6pd2 T A 5: 61,809,117 D78E probably benign Het
Gas2l2 A C 11: 83,423,344 S381A possibly damaging Het
Grk2 G A 19: 4,288,483 R474C probably damaging Het
Gxylt2 T A 6: 100,733,213 V105E probably benign Het
Hexdc T C 11: 121,216,987 V181A probably damaging Het
Ik T A 18: 36,744,787 D5E probably benign Het
Ilkap A G 1: 91,376,251 C163R Het
Itpr3 C T 17: 27,115,953 T2147I probably damaging Het
Kif1a A T 1: 93,022,451 V1418E probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,482,550 probably null Het
Lvrn A T 18: 46,900,542 D940V probably damaging Het
Mill1 G A 7: 18,263,102 R206H probably benign Het
Mrgpra1 A T 7: 47,335,520 L137Q probably damaging Het
Npc2 C A 12: 84,760,864 L73F probably benign Het
Olfr1042 T C 2: 86,160,337 E11G probably benign Het
Olfr1052 T C 2: 86,298,374 I186T probably benign Het
Olfr1447 A T 19: 12,901,657 V41E probably damaging Het
Olfr556 A T 7: 102,670,804 I295F possibly damaging Het
Olfr742 A G 14: 50,515,212 T3A probably benign Het
Osbpl1a T C 18: 12,819,508 H533R probably benign Het
Pax7 G A 4: 139,829,508 T147M probably benign Het
Pdik1l A T 4: 134,279,400 S143T unknown Het
Prkg1 T G 19: 30,786,971 T255P possibly damaging Het
Prmt2 A T 10: 76,225,379 I91N probably damaging Het
Ptprm A G 17: 66,809,489 Y932H probably damaging Het
Ptprz1 A T 6: 22,959,695 I64F probably damaging Het
Qrich2 T C 11: 116,447,120 K154R probably damaging Het
Rab8b T C 9: 66,919,542 D31G probably benign Het
Radil A G 5: 142,487,623 S768P probably damaging Het
Rbm5 A T 9: 107,744,953 D607E probably benign Het
Reep6 T A 10: 80,333,559 V131E probably damaging Het
Rrbp1 T A 2: 143,990,179 I23F probably damaging Het
Rubcn A T 16: 32,843,111 V385D probably benign Het
Sall2 C T 14: 52,314,667 G357D possibly damaging Het
Slc12a6 T A 2: 112,344,536 L547H probably damaging Het
Slc16a6 T C 11: 109,463,496 T100A probably benign Het
Sptbn2 T C 19: 4,750,507 L2250P probably damaging Het
Stab1 C T 14: 31,154,944 A808T probably benign Het
Stag1 A G 9: 100,928,098 T785A probably benign Het
Stambpl1 T G 19: 34,234,135 S199A probably benign Het
Supt20 C T 3: 54,715,594 S496L probably benign Het
Tanc1 T C 2: 59,795,852 F518L probably damaging Het
Tdpoz3 T A 3: 93,826,849 V277D probably benign Het
Ttc30a2 T C 2: 75,977,347 T274A probably benign Het
Unc45a A C 7: 80,325,655 Y934D probably damaging Het
Vmn1r192 G A 13: 22,187,949 P34S probably benign Het
Wipf3 T C 6: 54,489,019 S421P possibly damaging Het
Zfp296 A G 7: 19,580,302 K361E possibly damaging Het
Zfp882 T A 8: 71,914,071 N247K probably benign Het
Zfpm2 A G 15: 41,102,314 T732A possibly damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGCCACCCACTAGACAG -3'
(R):5'- CCACACATCTTCCCTTGCAGAG -3'

Sequencing Primer
(F):5'- AGGACTTACGATGTTACCCCCTAG -3'
(R):5'- GCAGAGGCTTCATTCACATCC -3'
Posted On 2022-11-14