Incidental Mutation 'R9694:Itpr3'
ID 735988
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9694 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27115953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 2147 (T2147I)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049308
AA Change: T2147I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: T2147I

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,849,573 Y948N probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adamts4 T C 1: 171,253,961 S395P probably benign Het
Adcy1 T C 11: 7,144,774 Y567H probably damaging Het
Agap3 A G 5: 24,477,141 N212D probably benign Het
Atp2a2 A G 5: 122,459,645 F775S probably damaging Het
Baz1b A T 5: 135,244,240 Q1406L probably benign Het
C030006K11Rik A T 15: 76,723,728 V30D possibly damaging Het
Ccdc144b A G 3: 36,018,943 S397P possibly damaging Het
Cep170b T A 12: 112,735,559 V262E probably damaging Het
Cgnl1 C T 9: 71,725,521 G183R probably benign Het
Chd8 A G 14: 52,203,884 I2257T possibly damaging Het
Chrna7 A G 7: 63,105,061 I266T probably damaging Het
Cyp3a25 A T 5: 145,986,875 Y319* probably null Het
Dcdc2a A T 13: 25,102,357 I125F probably benign Het
Dcdc2c A T 12: 28,535,554 I80N Het
Dmtn T C 14: 70,615,292 probably null Het
Dock2 T C 11: 34,268,054 N1172S probably benign Het
Dock9 A G 14: 121,581,379 S1564P probably damaging Het
Dusp27 A T 1: 166,101,085 S319R probably damaging Het
Ecel1 T C 1: 87,153,131 I350V possibly damaging Het
Eif4enif1 C T 11: 3,220,384 L146F probably damaging Het
Ergic1 T G 17: 26,624,611 D59E probably benign Het
F2rl2 A T 13: 95,701,542 D365V possibly damaging Het
Fbxl16 C T 17: 25,817,839 Q265* probably null Het
Fbxw26 T C 9: 109,746,067 probably benign Het
Fras1 A T 5: 96,781,686 Y3983F probably benign Het
G6pd2 T A 5: 61,809,117 D78E probably benign Het
Gas2l2 A C 11: 83,423,344 S381A possibly damaging Het
Grk2 G A 19: 4,288,483 R474C probably damaging Het
Gxylt2 T A 6: 100,733,213 V105E probably benign Het
Hexdc T C 11: 121,216,987 V181A probably damaging Het
Ik T A 18: 36,744,787 D5E probably benign Het
Ilkap A G 1: 91,376,251 C163R Het
Kif1a A T 1: 93,022,451 V1418E probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,482,550 probably null Het
Lvrn A T 18: 46,900,542 D940V probably damaging Het
Mill1 G A 7: 18,263,102 R206H probably benign Het
Mrgpra1 A T 7: 47,335,520 L137Q probably damaging Het
Npc2 C A 12: 84,760,864 L73F probably benign Het
Olfr1042 T C 2: 86,160,337 E11G probably benign Het
Olfr1052 T C 2: 86,298,374 I186T probably benign Het
Olfr1447 A T 19: 12,901,657 V41E probably damaging Het
Olfr556 A T 7: 102,670,804 I295F possibly damaging Het
Olfr742 A G 14: 50,515,212 T3A probably benign Het
Osbpl1a T C 18: 12,819,508 H533R probably benign Het
Pax7 G A 4: 139,829,508 T147M probably benign Het
Pdik1l A T 4: 134,279,400 S143T unknown Het
Prkg1 T G 19: 30,786,971 T255P possibly damaging Het
Prmt2 A T 10: 76,225,379 I91N probably damaging Het
Ptprm A G 17: 66,809,489 Y932H probably damaging Het
Ptprz1 A T 6: 22,959,695 I64F probably damaging Het
Qrich2 T C 11: 116,447,120 K154R probably damaging Het
Rab8b T C 9: 66,919,542 D31G probably benign Het
Radil A G 5: 142,487,623 S768P probably damaging Het
Rbm5 A T 9: 107,744,953 D607E probably benign Het
Reep6 T A 10: 80,333,559 V131E probably damaging Het
Rrbp1 T A 2: 143,990,179 I23F probably damaging Het
Rubcn A T 16: 32,843,111 V385D probably benign Het
Sall2 C T 14: 52,314,667 G357D possibly damaging Het
Slc12a6 T A 2: 112,344,536 L547H probably damaging Het
Slc16a6 T C 11: 109,463,496 T100A probably benign Het
Sptbn2 T C 19: 4,750,507 L2250P probably damaging Het
Stab1 C T 14: 31,154,944 A808T probably benign Het
Stag1 A G 9: 100,928,098 T785A probably benign Het
Stambpl1 T G 19: 34,234,135 S199A probably benign Het
Supt20 C T 3: 54,715,594 S496L probably benign Het
Tanc1 T C 2: 59,795,852 F518L probably damaging Het
Tdpoz3 T A 3: 93,826,849 V277D probably benign Het
Ttc30a2 T C 2: 75,977,347 T274A probably benign Het
Unc45a A C 7: 80,325,655 Y934D probably damaging Het
Vmn1r192 G A 13: 22,187,949 P34S probably benign Het
Wipf3 T C 6: 54,489,019 S421P possibly damaging Het
Zfp296 A G 7: 19,580,302 K361E possibly damaging Het
Zfp882 T A 8: 71,914,071 N247K probably benign Het
Zfpm2 A G 15: 41,102,314 T732A possibly damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27118677 unclassified probably benign
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27118677 unclassified probably benign
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9294:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9477:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
R9789:Itpr3 UTSW 17 27089941 missense probably benign 0.15
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAATCACACCTCGCAGATTG -3'
(R):5'- ACCAGTAGATGAGCGGCATG -3'

Sequencing Primer
(F):5'- CCTCGCAGATTGAGGTGAG -3'
(R):5'- GTCCCTGACGAACCCTCTG -3'
Posted On 2022-11-14