Incidental Mutation 'R9730:Ppp1r3a'
ID 736009
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9730 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 14721923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 301 (A301D)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: A301D

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: A301D

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,829,534 (GRCm39) R807Q probably benign Het
Alms1 G A 6: 85,606,420 (GRCm39) R2221Q probably benign Het
Alox12 C T 11: 70,140,920 (GRCm39) A372T probably benign Het
Ank2 T C 3: 127,019,493 (GRCm39) M2V Het
Cdon A G 9: 35,398,263 (GRCm39) I993M probably benign Het
Chil5 T C 3: 105,926,470 (GRCm39) T120A possibly damaging Het
Clca4b T C 3: 144,632,979 (GRCm39) H157R probably damaging Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cyp39a1 A G 17: 43,991,029 (GRCm39) N113D probably benign Het
Dact3 A G 7: 16,609,540 (GRCm39) E64G possibly damaging Het
Dennd3 A G 15: 73,426,959 (GRCm39) K779E probably damaging Het
Etnppl C T 3: 130,415,958 (GRCm39) A115V probably damaging Het
Exoc6 C T 19: 37,588,032 (GRCm39) T555I probably benign Het
Fbxw11 A G 11: 32,688,395 (GRCm39) T419A probably damaging Het
Hcn4 G T 9: 58,731,493 (GRCm39) M233I unknown Het
Hgfac T C 5: 35,204,282 (GRCm39) V515A probably damaging Het
Hikeshi T C 7: 89,569,371 (GRCm39) Y150C probably benign Het
Igf1r A G 7: 67,839,423 (GRCm39) Y645C probably damaging Het
Iqgap1 A G 7: 80,401,124 (GRCm39) I521T possibly damaging Het
Ldhal6b A G 17: 5,468,094 (GRCm39) V280A possibly damaging Het
Map1s C T 8: 71,369,178 (GRCm39) A909V possibly damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Or5b106 T A 19: 13,123,747 (GRCm39) Y92F possibly damaging Het
Plaa G A 4: 94,466,660 (GRCm39) P484S probably benign Het
Prdm2 A G 4: 142,858,659 (GRCm39) S1544P possibly damaging Het
Scara3 A G 14: 66,168,261 (GRCm39) V452A probably damaging Het
Slc12a9 T A 5: 137,325,732 (GRCm39) D293V probably benign Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Smg1 T C 7: 117,783,004 (GRCm39) N1101S unknown Het
Spocd1 A G 4: 129,850,305 (GRCm39) probably benign Het
Synj1 A T 16: 90,757,552 (GRCm39) D865E probably damaging Het
Trim21 T C 7: 102,213,247 (GRCm39) D17G probably benign Het
Try4 A T 6: 41,281,996 (GRCm39) D194V probably damaging Het
Zfp30 A G 7: 29,492,139 (GRCm39) E212G probably damaging Het
Zfp445 A C 9: 122,681,490 (GRCm39) I817R probably damaging Het
Zfp534 A T 4: 147,759,378 (GRCm39) H430Q probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGGGACAGAGTAAGCCATGC -3'
(R):5'- GTAAAGAAGAACCATTGCTAGCACC -3'

Sequencing Primer
(F):5'- AGCCATGCTTGCACATTTG -3'
(R):5'- GAACCATTGCTAGCACCAGAAG -3'
Posted On 2022-11-14