Incidental Mutation 'R9451:Dock9'
ID 736039
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 121787601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
Predicted Effect probably benign
Transcript: ENSMUST00000212376
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 T A 10: 21,265,032 (GRCm39) S220T probably benign Het
Ankrd66 A G 17: 43,845,811 (GRCm39) V192A probably benign Het
Aoc1l3 A G 6: 48,965,774 (GRCm39) Y594C probably damaging Het
Atp1a2 A G 1: 172,103,494 (GRCm39) Y1009H probably benign Het
Bptf A C 11: 106,935,411 (GRCm39) M142R probably damaging Het
Brwd1 C T 16: 95,845,703 (GRCm39) R740Q probably damaging Het
C3 A G 17: 57,531,169 (GRCm39) M339T probably benign Het
Catsperg1 A G 7: 28,897,772 (GRCm39) probably null Het
Cep295nl T A 11: 118,224,446 (GRCm39) K133* probably null Het
Copg2 A T 6: 30,793,786 (GRCm39) probably benign Het
Coro7 A T 16: 4,488,402 (GRCm39) D89E probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Ddx54 G T 5: 120,765,209 (GRCm39) R826L probably damaging Het
Dlg4 G T 11: 69,922,065 (GRCm39) K162N probably damaging Het
Dna2 T A 10: 62,790,072 (GRCm39) L185H probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Etl4 A G 2: 20,813,926 (GRCm39) I1322V probably benign Het
Exd1 T C 2: 119,355,064 (GRCm39) K284E possibly damaging Het
Flnc A G 6: 29,445,462 (GRCm39) T786A probably damaging Het
Gm29106 A C 1: 118,127,644 (GRCm39) E445D possibly damaging Het
Gm5592 T C 7: 40,935,876 (GRCm39) L126P probably damaging Het
Grep1 A G 17: 23,936,187 (GRCm39) Y19H unknown Het
Gtf3c2 T G 5: 31,325,773 (GRCm39) T389P probably damaging Het
Hhipl1 C A 12: 108,294,100 (GRCm39) R669S probably benign Het
Hivep1 A G 13: 42,337,252 (GRCm39) T2444A probably benign Het
Hspg2 A G 4: 137,238,380 (GRCm39) E289G probably damaging Het
Htatip2 C A 7: 49,408,987 (GRCm39) T9K unknown Het
Ifngr1 T C 10: 19,483,041 (GRCm39) V265A possibly damaging Het
Ift140 A G 17: 25,252,925 (GRCm39) N359D probably benign Het
Mat1a A G 14: 40,836,803 (GRCm39) R178G probably damaging Het
Mknk2 C T 10: 80,505,496 (GRCm39) R154H probably benign Het
Myh14 C T 7: 44,273,743 (GRCm39) probably null Het
Myof A G 19: 37,966,096 (GRCm39) probably null Het
Nfe2l1 G T 11: 96,718,453 (GRCm39) D27E probably damaging Het
Or1ad6 A G 11: 50,859,950 (GRCm39) Y35C Het
Or4a15 A T 2: 89,193,243 (GRCm39) C177S probably damaging Het
Or4k51 T C 2: 111,585,218 (GRCm39) V208A probably benign Het
Or5p61 A G 7: 107,758,468 (GRCm39) V204A probably benign Het
Or8s5 A G 15: 98,238,144 (GRCm39) V242A possibly damaging Het
Plec C A 15: 76,067,987 (GRCm39) Q1139H unknown Het
Plxna2 T A 1: 194,326,692 (GRCm39) S209T probably benign Het
Plxnd1 T C 6: 115,940,277 (GRCm39) E1369G possibly damaging Het
Psd3 T C 8: 68,363,487 (GRCm39) I3V unknown Het
Pwp1 T A 10: 85,714,428 (GRCm39) F195L probably damaging Het
Rab3ip C T 10: 116,775,354 (GRCm39) M1I probably null Het
Rad54l2 T C 9: 106,585,488 (GRCm39) K759R probably benign Het
Rims2 G T 15: 39,300,724 (GRCm39) V344L probably damaging Het
Robo1 G A 16: 72,803,718 (GRCm39) R1088Q probably benign Het
Rtf2 A G 2: 172,282,745 (GRCm39) probably benign Het
Serhl A C 15: 82,987,167 (GRCm39) K131N possibly damaging Het
Sidt1 T A 16: 44,075,392 (GRCm39) probably null Het
Slc27a1 T A 8: 72,032,808 (GRCm39) Y248* probably null Het
Slitrk3 T A 3: 72,958,616 (GRCm39) E52V possibly damaging Het
Snx2 T C 18: 53,343,415 (GRCm39) V271A probably benign Het
Snx9 C A 17: 5,949,768 (GRCm39) P156Q probably damaging Het
Spag6 C A 2: 18,715,369 (GRCm39) Y71* probably null Het
Speer4a3 T A 5: 26,156,569 (GRCm39) K137* probably null Het
Speg A G 1: 75,394,377 (GRCm39) D1724G probably damaging Het
Syt7 A G 19: 10,421,532 (GRCm39) N572S probably damaging Het
Thoc2l C A 5: 104,668,644 (GRCm39) S1055R probably benign Het
Ticam2 A G 18: 46,693,766 (GRCm39) I107T probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem268 G A 4: 63,488,256 (GRCm39) V135M probably benign Het
Toporsl A G 4: 52,611,663 (GRCm39) T519A possibly damaging Het
Trim43b G A 9: 88,973,608 (GRCm39) L42F possibly damaging Het
Ttf2 A C 3: 100,852,089 (GRCm39) V1019G probably damaging Het
Ugt3a1 A G 15: 9,292,158 (GRCm39) D97G probably benign Het
Uncx A G 5: 139,532,475 (GRCm39) N180S probably damaging Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Vmn2r51 A T 7: 9,833,816 (GRCm39) H407Q probably damaging Het
Wdfy4 C T 14: 32,855,518 (GRCm39) E699K Het
Wdr95 A G 5: 149,504,165 (GRCm39) T324A probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTCATTGAATGCTCACAC -3'
(R):5'- TACGTGAAGAAGCGGATCCC -3'

Sequencing Primer
(F):5'- GAATGCTCACACTGCCCTG -3'
(R):5'- AGAAGCGGATCCCTGTCATGTAC -3'
Posted On 2022-11-16