Incidental Mutation 'R9451:Dock9'
ID 736039
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 121550189 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
Predicted Effect probably benign
Transcript: ENSMUST00000212376
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,717,213 Y19H unknown Het
Aldh8a1 T A 10: 21,389,133 S220T probably benign Het
Ankrd66 A G 17: 43,534,920 V192A probably benign Het
Atp1a2 A G 1: 172,275,927 Y1009H probably benign Het
BC005561 C A 5: 104,520,778 S1055R probably benign Het
Bptf A C 11: 107,044,585 M142R probably damaging Het
Brwd1 C T 16: 96,044,503 R740Q probably damaging Het
C3 A G 17: 57,224,169 M339T probably benign Het
Catsperg1 A G 7: 29,198,347 probably null Het
Cep295nl T A 11: 118,333,620 K133* probably null Het
Copg2 A T 6: 30,816,851 probably benign Het
Coro7 A T 16: 4,670,538 D89E probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Ddx54 G T 5: 120,627,144 R826L probably damaging Het
Dlg4 G T 11: 70,031,239 K162N probably damaging Het
Dna2 T A 10: 62,954,293 L185H probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Etl4 A G 2: 20,809,115 I1322V probably benign Het
Exd1 T C 2: 119,524,583 K284E possibly damaging Het
Flnc A G 6: 29,445,463 T786A probably damaging Het
Gm21671 T A 5: 25,951,571 K137* probably null Het
Gm29106 A C 1: 118,199,914 E445D possibly damaging Het
Gm5592 T C 7: 41,286,452 L126P probably damaging Het
Gtf3c2 T G 5: 31,168,429 T389P probably damaging Het
Hhipl1 C A 12: 108,327,841 R669S probably benign Het
Hivep1 A G 13: 42,183,776 T2444A probably benign Het
Hspg2 A G 4: 137,511,069 E289G probably damaging Het
Htatip2 C A 7: 49,759,239 T9K unknown Het
Ifngr1 T C 10: 19,607,293 V265A possibly damaging Het
Ift140 A G 17: 25,033,951 N359D probably benign Het
Mat1a A G 14: 41,114,846 R178G probably damaging Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Myh14 C T 7: 44,624,319 probably null Het
Myof A G 19: 37,977,648 probably null Het
Nfe2l1 G T 11: 96,827,627 D27E probably damaging Het
Olfr1234 A T 2: 89,362,899 C177S probably damaging Het
Olfr1301 T C 2: 111,754,873 V208A probably benign Het
Olfr1378 A G 11: 50,969,123 Y35C Het
Olfr284 A G 15: 98,340,263 V242A possibly damaging Het
Olfr485 A G 7: 108,159,261 V204A probably benign Het
Plec C A 15: 76,183,787 Q1139H unknown Het
Plxna2 T A 1: 194,644,384 S209T probably benign Het
Plxnd1 T C 6: 115,963,316 E1369G possibly damaging Het
Psd3 T C 8: 67,910,835 I3V unknown Het
Pwp1 T A 10: 85,878,564 F195L probably damaging Het
Rab3ip C T 10: 116,939,449 M1I probably null Het
Rad54l2 T C 9: 106,708,289 K759R probably benign Het
Rims2 G T 15: 39,437,328 V344L probably damaging Het
Robo1 G A 16: 73,006,830 R1088Q probably benign Het
Rtf2 A G 2: 172,440,825 probably benign Het
Serhl A C 15: 83,102,966 K131N possibly damaging Het
Sidt1 T A 16: 44,255,029 probably null Het
Slc27a1 T A 8: 71,580,164 Y248* probably null Het
Slitrk3 T A 3: 73,051,283 E52V possibly damaging Het
Snx2 T C 18: 53,210,343 V271A probably benign Het
Snx9 C A 17: 5,899,493 P156Q probably damaging Het
Spag6 C A 2: 18,710,558 Y71* probably null Het
Speg A G 1: 75,417,733 D1724G probably damaging Het
Svs1 A G 6: 48,988,840 Y594C probably damaging Het
Syt7 A G 19: 10,444,168 N572S probably damaging Het
Ticam2 A G 18: 46,560,699 I107T probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem268 G A 4: 63,570,019 V135M probably benign Het
Toporsl A G 4: 52,611,663 T519A possibly damaging Het
Trim43b G A 9: 89,091,555 L42F possibly damaging Het
Ttf2 A C 3: 100,944,773 V1019G probably damaging Het
Ugt3a1 A G 15: 9,292,072 D97G probably benign Het
Uncx A G 5: 139,546,720 N180S probably damaging Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Vmn2r51 A T 7: 10,099,889 H407Q probably damaging Het
Wdfy4 C T 14: 33,133,561 E699K Het
Wdr95 A G 5: 149,580,700 T324A probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTCATTGAATGCTCACAC -3'
(R):5'- TACGTGAAGAAGCGGATCCC -3'

Sequencing Primer
(F):5'- GAATGCTCACACTGCCCTG -3'
(R):5'- AGAAGCGGATCCCTGTCATGTAC -3'
Posted On 2022-11-16