Incidental Mutation 'R9532:Washc4'
ID 736051
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene Name WASH complex subunit 4
Synonyms A230046K03Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R9532 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83379616-83432337 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 83417258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
AlphaFold Q3UMB9
Predicted Effect probably benign
Transcript: ENSMUST00000038388
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,350,397 (GRCm39) N165S unknown Het
9530002B09Rik C A 4: 122,596,133 (GRCm39) N121K unknown Het
Abca1 A T 4: 53,109,284 (GRCm39) N141K probably benign Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 94,470,889 (GRCm39) probably benign Het
Bco2 T C 9: 50,457,371 (GRCm39) N57S probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Cacna1a T A 8: 85,338,246 (GRCm39) W1709R probably damaging Het
Cep95 A G 11: 106,687,042 (GRCm39) E117G probably damaging Het
D17H6S53E T A 17: 35,346,145 (GRCm39) S19T possibly damaging Het
Dab2 G T 15: 6,451,762 (GRCm39) R126L probably damaging Het
Diaph3 T C 14: 86,893,916 (GRCm39) D31G probably damaging Het
Espl1 T A 15: 102,228,260 (GRCm39) L1678* probably null Het
Fam171b T C 2: 83,710,212 (GRCm39) V628A probably damaging Het
Fgf8 A T 19: 45,725,679 (GRCm39) V186E probably damaging Het
Fmnl2 A T 2: 53,006,941 (GRCm39) Y751F unknown Het
Frmpd1 A T 4: 45,278,886 (GRCm39) E537V Het
Garin3 A G 11: 46,297,673 (GRCm39) T326A Het
Grin1 C T 2: 25,187,909 (GRCm39) G529D probably damaging Het
Heatr1 C T 13: 12,429,306 (GRCm39) T872I possibly damaging Het
Hectd4 T C 5: 121,502,616 (GRCm39) I4240T probably benign Het
Hpd C T 5: 123,312,532 (GRCm39) R279H possibly damaging Het
Hyls1 T A 9: 35,473,398 (GRCm39) Q6L probably benign Het
Igfn1 A T 1: 135,897,229 (GRCm39) D1112E possibly damaging Het
Ighv1-82 T G 12: 115,916,158 (GRCm39) R117S probably damaging Het
Iqch G A 9: 63,389,935 (GRCm39) A748V Het
Kcnd2 G T 6: 21,727,180 (GRCm39) A578S probably benign Het
Klc2 A G 19: 5,161,565 (GRCm39) V315A possibly damaging Het
Klhl20 A T 1: 160,937,329 (GRCm39) D15E probably benign Het
Lamb2 G T 9: 108,365,830 (GRCm39) G1445W probably damaging Het
Lhx4 T A 1: 155,586,024 (GRCm39) I96F probably damaging Het
Lyzl6 T C 11: 103,522,168 (GRCm39) T143A probably benign Het
Nup93 G A 8: 95,041,249 (GRCm39) A796T probably damaging Het
Nutm2 T C 13: 50,628,475 (GRCm39) V513A probably benign Het
Or51s1 A G 7: 102,558,746 (GRCm39) V100A probably benign Het
Or52e4 A T 7: 104,706,275 (GRCm39) H274L probably damaging Het
Pcdh8 A G 14: 80,008,206 (GRCm39) V119A possibly damaging Het
Pkmyt1 T C 17: 23,954,691 (GRCm39) I427T probably benign Het
Polr1g A T 7: 19,091,817 (GRCm39) S97T possibly damaging Het
Polr3c T C 3: 96,629,866 (GRCm39) D222G probably null Het
Prickle2 A T 6: 92,683,096 (GRCm39) S11T probably benign Het
Prpf8 G A 11: 75,385,608 (GRCm39) A930T probably benign Het
Prss40 G T 1: 34,597,106 (GRCm39) H147Q probably damaging Het
Prune2 A T 19: 17,099,794 (GRCm39) D1766V probably benign Het
Qrich1 C T 9: 108,411,519 (GRCm39) T348M probably benign Het
Slc20a1 T C 2: 129,041,933 (GRCm39) Y99H probably damaging Het
Slc6a15 T C 10: 103,240,333 (GRCm39) V352A probably damaging Het
Ttll3 A G 6: 113,385,970 (GRCm39) Q601R possibly damaging Het
Virma T C 4: 11,507,078 (GRCm39) probably null Het
Zdhhc18 A T 4: 133,342,541 (GRCm39) M191K possibly damaging Het
Zfp281 A G 1: 136,554,894 (GRCm39) N624S probably benign Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83,386,747 (GRCm39) missense probably benign 0.07
IGL01370:Washc4 APN 10 83,394,694 (GRCm39) missense probably damaging 0.98
IGL01524:Washc4 APN 10 83,411,996 (GRCm39) missense probably benign 0.37
IGL01682:Washc4 APN 10 83,416,170 (GRCm39) missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83,391,973 (GRCm39) missense probably damaging 0.99
IGL02002:Washc4 APN 10 83,415,407 (GRCm39) missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83,400,336 (GRCm39) missense probably damaging 0.97
IGL02230:Washc4 APN 10 83,417,233 (GRCm39) missense probably benign 0.00
IGL02421:Washc4 APN 10 83,415,414 (GRCm39) missense probably damaging 0.98
IGL02514:Washc4 APN 10 83,405,947 (GRCm39) missense probably damaging 0.98
IGL02619:Washc4 APN 10 83,394,717 (GRCm39) missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83,419,173 (GRCm39) missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83,421,740 (GRCm39) missense probably benign
IGL03181:Washc4 APN 10 83,426,883 (GRCm39) missense probably damaging 1.00
IGL03247:Washc4 APN 10 83,400,327 (GRCm39) missense probably benign 0.02
R0458:Washc4 UTSW 10 83,382,663 (GRCm39) missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83,392,777 (GRCm39) missense probably benign 0.00
R0471:Washc4 UTSW 10 83,394,598 (GRCm39) splice site probably benign
R1144:Washc4 UTSW 10 83,416,194 (GRCm39) missense probably damaging 0.97
R1560:Washc4 UTSW 10 83,391,973 (GRCm39) missense probably damaging 0.99
R1789:Washc4 UTSW 10 83,415,389 (GRCm39) missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83,386,748 (GRCm39) missense probably benign 0.08
R2421:Washc4 UTSW 10 83,415,385 (GRCm39) missense probably damaging 0.97
R2882:Washc4 UTSW 10 83,415,365 (GRCm39) missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83,390,627 (GRCm39) nonsense probably null
R3436:Washc4 UTSW 10 83,405,866 (GRCm39) missense probably benign 0.33
R3437:Washc4 UTSW 10 83,405,866 (GRCm39) missense probably benign 0.33
R3552:Washc4 UTSW 10 83,382,720 (GRCm39) missense probably benign 0.45
R4646:Washc4 UTSW 10 83,410,407 (GRCm39) missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83,410,407 (GRCm39) missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83,410,407 (GRCm39) missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83,410,343 (GRCm39) missense probably benign
R4733:Washc4 UTSW 10 83,410,343 (GRCm39) missense probably benign
R4750:Washc4 UTSW 10 83,426,916 (GRCm39) missense probably damaging 0.99
R4835:Washc4 UTSW 10 83,415,376 (GRCm39) missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83,419,200 (GRCm39) missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83,392,771 (GRCm39) missense probably damaging 0.99
R5414:Washc4 UTSW 10 83,391,967 (GRCm39) missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83,415,418 (GRCm39) missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83,410,386 (GRCm39) missense probably benign 0.00
R5506:Washc4 UTSW 10 83,417,201 (GRCm39) missense probably damaging 0.97
R5540:Washc4 UTSW 10 83,409,657 (GRCm39) missense probably damaging 0.99
R5667:Washc4 UTSW 10 83,405,892 (GRCm39) missense probably damaging 0.97
R5671:Washc4 UTSW 10 83,405,892 (GRCm39) missense probably damaging 0.97
R5777:Washc4 UTSW 10 83,391,469 (GRCm39) missense probably damaging 1.00
R6369:Washc4 UTSW 10 83,410,308 (GRCm39) missense probably damaging 1.00
R6370:Washc4 UTSW 10 83,407,226 (GRCm39) missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83,394,687 (GRCm39) missense probably damaging 1.00
R6645:Washc4 UTSW 10 83,408,059 (GRCm39) nonsense probably null
R6657:Washc4 UTSW 10 83,394,482 (GRCm39) missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83,396,380 (GRCm39) missense probably damaging 0.97
R6862:Washc4 UTSW 10 83,394,757 (GRCm39) missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83,411,919 (GRCm39) missense probably benign 0.07
R7144:Washc4 UTSW 10 83,409,638 (GRCm39) critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83,426,897 (GRCm39) missense probably damaging 0.99
R7477:Washc4 UTSW 10 83,410,307 (GRCm39) missense probably damaging 0.99
R7900:Washc4 UTSW 10 83,409,637 (GRCm39) splice site probably null
R8194:Washc4 UTSW 10 83,416,163 (GRCm39) missense possibly damaging 0.51
R8491:Washc4 UTSW 10 83,411,987 (GRCm39) missense probably benign 0.24
R8791:Washc4 UTSW 10 83,386,748 (GRCm39) missense probably benign 0.08
R8804:Washc4 UTSW 10 83,408,015 (GRCm39) missense probably damaging 0.99
R8896:Washc4 UTSW 10 83,405,882 (GRCm39) missense probably damaging 0.98
R8961:Washc4 UTSW 10 83,409,657 (GRCm39) missense probably damaging 0.99
R9084:Washc4 UTSW 10 83,422,499 (GRCm39) missense possibly damaging 0.92
R9452:Washc4 UTSW 10 83,396,387 (GRCm39) missense probably benign
X0017:Washc4 UTSW 10 83,427,007 (GRCm39) missense probably damaging 1.00
X0066:Washc4 UTSW 10 83,394,693 (GRCm39) frame shift probably null
Z1088:Washc4 UTSW 10 83,412,605 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCAGGGAACATGAGTATTTCAG -3'
(R):5'- TCCACTTTATGCTTAAGCCTACAG -3'

Sequencing Primer
(F):5'- TTTGAACATTTCAGCTCCAGTAG -3'
(R):5'- TGCTTAAGCCTACAGAGAACATAAG -3'
Posted On 2023-03-08