Incidental Mutation 'R0800:Il17f'
ID76208
Institutional Source Beutler Lab
Gene Symbol Il17f
Ensembl Gene ENSMUSG00000041872
Gene Nameinterleukin 17F
Synonyms
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0800 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20777146-20790617 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 20777953 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 100 (C100*)
Ref Sequence ENSEMBL: ENSMUSP00000140122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039046] [ENSMUST00000189301]
Predicted Effect probably null
Transcript: ENSMUST00000039046
AA Change: C100*
SMART Domains Protein: ENSMUSP00000046960
Gene: ENSMUSG00000041872
AA Change: C100*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 75 153 3.8e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189301
AA Change: C100*
SMART Domains Protein: ENSMUSP00000140122
Gene: ENSMUSG00000041872
AA Change: C100*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 74 154 5.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191111
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele exhibit increased susceptibility to oral bacterial infection while mice homozygous for another null allele exhibit decreased susceptibility to experimental models of colitis and CNS inflammation but have enhanced inflammatory responses to a chronic asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Ces3b T A 8: 105,085,269 D103E possibly damaging Het
Chd5 A G 4: 152,356,157 Y158C probably damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dok7 T C 5: 35,075,289 probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fer1l4 A G 2: 156,045,663 F538L possibly damaging Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Palm2 T A 4: 57,709,650 D198E probably benign Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Usp19 A G 9: 108,495,154 E469G probably damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Il17f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2224:Il17f UTSW 1 20779375 missense probably damaging 0.97
R4074:Il17f UTSW 1 20777763 unclassified probably benign
R4594:Il17f UTSW 1 20777802 missense probably damaging 1.00
R5386:Il17f UTSW 1 20777957 missense probably benign 0.00
R6009:Il17f UTSW 1 20779286 splice site probably null
R6416:Il17f UTSW 1 20777907 missense probably benign 0.00
R6751:Il17f UTSW 1 20779489 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTTGGAGATCGGGCTTCACAC -3'
(R):5'- TCAGAACTGCCCCTGAAGGGAAAC -3'

Sequencing Primer
(F):5'- TTTTCTCAGTGGAAGTCTTCAAC -3'
(R):5'- CACCTAGTGCTGCGGAAAC -3'
Posted On2013-10-16