Incidental Mutation 'R0800:Fer1l4'
ID76221
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0800 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156045663 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 538 (F538L)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109611
AA Change: F538L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: F538L

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Ces3b T A 8: 105,085,269 D103E possibly damaging Het
Chd5 A G 4: 152,356,157 Y158C probably damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dok7 T C 5: 35,075,289 probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Il17f G T 1: 20,777,953 C100* probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Palm2 T A 4: 57,709,650 D198E probably benign Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Usp19 A G 9: 108,495,154 E469G probably damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 156048934 missense probably benign
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 156024635 missense probably benign 0.03
R8171:Fer1l4 UTSW 2 156048231 missense probably benign 0.29
R8241:Fer1l4 UTSW 2 156049665 missense probably benign
R8245:Fer1l4 UTSW 2 156045014 critical splice donor site probably null
R8280:Fer1l4 UTSW 2 156049700 missense probably damaging 1.00
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACTGGCAGGCTGTAAAATG -3'
(R):5'- CGTGACAATGCACCTCTTGTGGATG -3'

Sequencing Primer
(F):5'- GCTGTAAAATGCCAGCCG -3'
(R):5'- CTGAGGCAGATCTCGAACTC -3'
Posted On2013-10-16