Incidental Mutation 'R0800:Palm2'
ID76226
Institutional Source Beutler Lab
Gene Symbol Palm2
Ensembl Gene ENSMUSG00000090053
Gene Nameparalemmin 2
Synonyms53-H12, pEN70
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0800 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location57434247-57712016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57709650 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 198 (D198E)
Ref Sequence ENSEMBL: ENSMUSP00000099969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098066] [ENSMUST00000102904] [ENSMUST00000102905] [ENSMUST00000126465] [ENSMUST00000142556]
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102904
AA Change: D198E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099968
Gene: ENSMUSG00000090053
AA Change: D198E

DomainStartEndE-ValueType
Pfam:Paralemmin 66 376 8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102905
AA Change: D198E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099969
Gene: ENSMUSG00000090053
AA Change: D198E

DomainStartEndE-ValueType
Pfam:Paralemmin 67 376 5.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131201
Predicted Effect probably benign
Transcript: ENSMUST00000142556
SMART Domains Protein: ENSMUSP00000129817
Gene: ENSMUSG00000090053

DomainStartEndE-ValueType
Pfam:Paralemmin 66 136 8.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150412
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Ces3b T A 8: 105,085,269 D103E possibly damaging Het
Chd5 A G 4: 152,356,157 Y158C probably damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dok7 T C 5: 35,075,289 probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fer1l4 A G 2: 156,045,663 F538L possibly damaging Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Il17f G T 1: 20,777,953 C100* probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Usp19 A G 9: 108,495,154 E469G probably damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Palm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02736:Palm2 APN 4 57709721 missense probably damaging 0.96
PIT4305001:Palm2 UTSW 4 57638029 missense possibly damaging 0.94
R0158:Palm2 UTSW 4 57709649 missense possibly damaging 0.96
R0244:Palm2 UTSW 4 57710177 missense possibly damaging 0.74
R0763:Palm2 UTSW 4 57688441 missense probably damaging 1.00
R1861:Palm2 UTSW 4 57709468 missense probably damaging 0.97
R1895:Palm2 UTSW 4 57638068 missense probably benign 0.01
R4600:Palm2 UTSW 4 57709954 missense probably benign 0.26
R6320:Palm2 UTSW 4 57710173 missense probably damaging 1.00
R6365:Palm2 UTSW 4 57709675 nonsense probably null
R6983:Palm2 UTSW 4 57709973 missense probably damaging 1.00
R7090:Palm2 UTSW 4 57648042 missense probably benign 0.00
R7726:Palm2 UTSW 4 57709876 missense probably damaging 1.00
R7744:Palm2 UTSW 4 57709519 missense probably damaging 0.97
X0065:Palm2 UTSW 4 57709805 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCAAGATTCTCTCTGCATCCACC -3'
(R):5'- TCCGCCTTGATGGTTTCGTCATAG -3'

Sequencing Primer
(F):5'- TCCACCATTGGCCCAGAG -3'
(R):5'- ATGGTTTCGTCATAGCCTAGCAC -3'
Posted On2013-10-16