Incidental Mutation 'R0800:Chd5'
ID76227
Institutional Source Beutler Lab
Gene Symbol Chd5
Ensembl Gene ENSMUSG00000005045
Gene Namechromodomain helicase DNA binding protein 5
Synonyms
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0800 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152338651-152390194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152356157 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 158 (Y158C)
Ref Sequence ENSEMBL: ENSMUSP00000132600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005175
AA Change: Y158C

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: Y158C

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030775
AA Change: Y158C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: Y158C

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145163
Predicted Effect probably damaging
Transcript: ENSMUST00000164662
AA Change: Y158C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: Y158C

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Meta Mutation Damage Score 0.7295 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Ces3b T A 8: 105,085,269 D103E possibly damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dok7 T C 5: 35,075,289 probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fer1l4 A G 2: 156,045,663 F538L possibly damaging Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Il17f G T 1: 20,777,953 C100* probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Palm2 T A 4: 57,709,650 D198E probably benign Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Usp19 A G 9: 108,495,154 E469G probably damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Chd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Chd5 APN 4 152360602 missense probably damaging 1.00
IGL00886:Chd5 APN 4 152359699 missense probably benign 0.00
IGL00963:Chd5 APN 4 152382938 missense probably damaging 1.00
IGL01399:Chd5 APN 4 152356687 missense probably damaging 1.00
IGL01571:Chd5 APN 4 152384115 splice site probably benign
IGL01606:Chd5 APN 4 152360975 missense probably damaging 0.99
IGL01636:Chd5 APN 4 152384653 nonsense probably null
IGL02009:Chd5 APN 4 152366213 missense probably damaging 1.00
IGL02417:Chd5 APN 4 152367294 missense probably damaging 0.97
IGL02504:Chd5 APN 4 152363322 missense probably damaging 0.99
IGL02508:Chd5 APN 4 152363024 missense probably damaging 1.00
IGL02597:Chd5 APN 4 152371712 missense probably damaging 1.00
IGL02608:Chd5 APN 4 152356107 missense possibly damaging 0.94
IGL02612:Chd5 APN 4 152360576 missense probably damaging 1.00
IGL02658:Chd5 APN 4 152360593 missense probably damaging 1.00
IGL02662:Chd5 APN 4 152372131 missense probably damaging 1.00
IGL02676:Chd5 APN 4 152356073 splice site probably benign
IGL02871:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL02942:Chd5 APN 4 152385725 missense probably damaging 0.98
IGL02956:Chd5 APN 4 152379956 missense probably benign 0.00
IGL03286:Chd5 APN 4 152385495 missense probably benign 0.00
IGL03348:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL03398:Chd5 APN 4 152377082 missense probably damaging 0.97
PIT1430001:Chd5 UTSW 4 152370637 missense probably damaging 1.00
PIT4151001:Chd5 UTSW 4 152378529 missense probably damaging 0.99
R0079:Chd5 UTSW 4 152385749 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0379:Chd5 UTSW 4 152383321 missense probably benign 0.00
R0388:Chd5 UTSW 4 152371644 missense probably damaging 1.00
R0675:Chd5 UTSW 4 152385950 missense probably benign 0.06
R0730:Chd5 UTSW 4 152347984 missense possibly damaging 0.72
R0799:Chd5 UTSW 4 152384159 missense probably damaging 1.00
R1276:Chd5 UTSW 4 152378734 missense probably damaging 1.00
R1752:Chd5 UTSW 4 152375133 missense probably damaging 1.00
R1753:Chd5 UTSW 4 152378815 missense probably damaging 1.00
R1843:Chd5 UTSW 4 152385806 missense probably damaging 1.00
R1850:Chd5 UTSW 4 152370533 missense probably damaging 1.00
R1851:Chd5 UTSW 4 152378270 missense probably damaging 0.97
R1859:Chd5 UTSW 4 152380523 missense probably benign 0.00
R1983:Chd5 UTSW 4 152384666 missense possibly damaging 0.89
R2404:Chd5 UTSW 4 152367334 missense probably damaging 1.00
R2897:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R2898:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R3893:Chd5 UTSW 4 152360656 missense probably damaging 1.00
R3938:Chd5 UTSW 4 152377055 missense probably benign 0.05
R4707:Chd5 UTSW 4 152360582 missense probably damaging 1.00
R4754:Chd5 UTSW 4 152377746 missense probably damaging 0.99
R4911:Chd5 UTSW 4 152360672 missense probably damaging 1.00
R4924:Chd5 UTSW 4 152366429 missense possibly damaging 0.50
R4926:Chd5 UTSW 4 152383311 missense probably benign 0.00
R5256:Chd5 UTSW 4 152372097 missense probably benign 0.01
R5524:Chd5 UTSW 4 152376630 missense probably benign
R5552:Chd5 UTSW 4 152385815 missense possibly damaging 0.95
R5895:Chd5 UTSW 4 152379932 missense probably benign 0.13
R5945:Chd5 UTSW 4 152379951 missense probably benign
R6007:Chd5 UTSW 4 152379421 missense probably null 1.00
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6172:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6173:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6323:Chd5 UTSW 4 152367334 missense probably damaging 0.99
R6331:Chd5 UTSW 4 152382408 missense probably benign 0.02
R6495:Chd5 UTSW 4 152367372 missense probably damaging 1.00
R6528:Chd5 UTSW 4 152356676 missense probably damaging 1.00
R6849:Chd5 UTSW 4 152378538 missense probably damaging 1.00
R6854:Chd5 UTSW 4 152382938 missense probably damaging 1.00
R6859:Chd5 UTSW 4 152378207 missense probably damaging 1.00
R6999:Chd5 UTSW 4 152374434 missense probably damaging 1.00
R7034:Chd5 UTSW 4 152360941 missense possibly damaging 0.89
R7110:Chd5 UTSW 4 152385439 missense probably damaging 1.00
R7361:Chd5 UTSW 4 152363288 missense probably damaging 0.99
R7397:Chd5 UTSW 4 152368012 missense possibly damaging 0.82
R7440:Chd5 UTSW 4 152384651 missense probably benign 0.01
R7489:Chd5 UTSW 4 152373468 missense probably damaging 1.00
R7810:Chd5 UTSW 4 152358575 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGTTAGCTTGCAGACTGCCCC -3'
(R):5'- ACCCCAACATACTCCTGACTTCTGG -3'

Sequencing Primer
(F):5'- CTTTCTTACTCTCTCAGAGCAAGG -3'
(R):5'- TGTTAAAATGAAGGAGTCCTGACCC -3'
Posted On2013-10-16