Incidental Mutation 'R0800:Dok7'
ID76228
Institutional Source Beutler Lab
Gene Symbol Dok7
Ensembl Gene ENSMUSG00000044716
Gene Namedocking protein 7
SynonymsDok-7, Oit5, A930013K19Rik, EF-12
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0800 (G1)
Quality Score169
Status Validated
Chromosome5
Chromosomal Location35056766-35087839 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 35075289 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050709] [ENSMUST00000101298] [ENSMUST00000114270]
Predicted Effect probably benign
Transcript: ENSMUST00000050709
SMART Domains Protein: ENSMUSP00000059538
Gene: ENSMUSG00000044716

DomainStartEndE-ValueType
IRS 73 168 3.15e-26 SMART
low complexity region 212 243 N/A INTRINSIC
low complexity region 279 291 N/A INTRINSIC
low complexity region 306 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101298
SMART Domains Protein: ENSMUSP00000098856
Gene: ENSMUSG00000044716

DomainStartEndE-ValueType
Blast:PH 5 49 2e-11 BLAST
PDB:3ML4|D 35 76 4e-20 PDB
low complexity region 105 136 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114270
SMART Domains Protein: ENSMUSP00000109909
Gene: ENSMUSG00000044716

DomainStartEndE-ValueType
PH 5 111 7.9e-3 SMART
IRS 110 205 3.15e-26 SMART
low complexity region 249 280 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155097
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for neuromuscular synaptogenesis. The protein functions in aneural activation of muscle-specific receptor kinase, which is required for postsynaptic differentiation, and in the subsequent clustering of the acetylcholine receptor in myotubes. This protein can also induce autophosphorylation of muscle-specific receptor kinase. Mutations in this gene are a cause of familial limb-girdle myasthenia autosomal recessive, which is also known as congenital myasthenic syndrome type 1B. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, impaired neuromuscular synaptogenesis and akinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Ces3b T A 8: 105,085,269 D103E possibly damaging Het
Chd5 A G 4: 152,356,157 Y158C probably damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fer1l4 A G 2: 156,045,663 F538L possibly damaging Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Il17f G T 1: 20,777,953 C100* probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Palm2 T A 4: 57,709,650 D198E probably benign Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Usp19 A G 9: 108,495,154 E469G probably damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Dok7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dok7 APN 5 35079568 missense possibly damaging 0.49
P0022:Dok7 UTSW 5 35075411 missense probably damaging 1.00
R0255:Dok7 UTSW 5 35064334 missense probably damaging 1.00
R0462:Dok7 UTSW 5 35066462 missense possibly damaging 0.88
R0536:Dok7 UTSW 5 35066482 missense probably damaging 1.00
R1533:Dok7 UTSW 5 35064327 splice site probably null
R1659:Dok7 UTSW 5 35079139 missense possibly damaging 0.55
R1772:Dok7 UTSW 5 35086650 missense probably damaging 0.98
R1969:Dok7 UTSW 5 35077266 splice site probably null
R4321:Dok7 UTSW 5 35079797 utr 3 prime probably benign
R5864:Dok7 UTSW 5 35066546 missense probably damaging 1.00
R6047:Dok7 UTSW 5 35079307 missense probably damaging 1.00
R6773:Dok7 UTSW 5 35077184 missense probably damaging 1.00
R7003:Dok7 UTSW 5 35079555 missense probably benign 0.06
R7129:Dok7 UTSW 5 35079048 missense probably damaging 1.00
R7326:Dok7 UTSW 5 35064522 missense probably benign 0.11
R7399:Dok7 UTSW 5 35066471 missense probably damaging 1.00
R7712:Dok7 UTSW 5 35066522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGCTTGACAGCAGAGAGATAC -3'
(R):5'- TTGCTAGGCTGATGAAGCAGGTTAC -3'

Sequencing Primer
(F):5'- CTTGACAGCAGAGAGATACAAGGG -3'
(R):5'- AAGCAGGTTACCCATTTCTGGAC -3'
Posted On2013-10-16