Incidental Mutation 'R0800:Ces3b'
ID76234
Institutional Source Beutler Lab
Gene Symbol Ces3b
Ensembl Gene ENSMUSG00000062181
Gene Namecarboxylesterase 3B
SynonymsES31L, Gm4738
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0800 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105083753-105093929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105085269 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 103 (D103E)
Ref Sequence ENSEMBL: ENSMUSP00000090909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074403] [ENSMUST00000093221] [ENSMUST00000173088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074403
AA Change: D103E

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074004
Gene: ENSMUSG00000062181
AA Change: D103E

DomainStartEndE-ValueType
Pfam:COesterase 13 436 1.8e-127 PFAM
Pfam:Abhydrolase_3 147 303 2.8e-13 PFAM
Pfam:COesterase 423 497 5.8e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093221
AA Change: D103E

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090909
Gene: ENSMUSG00000062181
AA Change: D103E

DomainStartEndE-ValueType
Pfam:COesterase 13 547 9.5e-163 PFAM
Pfam:Abhydrolase_3 147 304 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173088
SMART Domains Protein: ENSMUSP00000134204
Gene: ENSMUSG00000062181

DomainStartEndE-ValueType
Pfam:COesterase 1 114 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173838
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Chd5 A G 4: 152,356,157 Y158C probably damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dok7 T C 5: 35,075,289 probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fer1l4 A G 2: 156,045,663 F538L possibly damaging Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Il17f G T 1: 20,777,953 C100* probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Palm2 T A 4: 57,709,650 D198E probably benign Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Usp19 A G 9: 108,495,154 E469G probably damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Ces3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces3b APN 8 105091574 missense probably benign 0.00
IGL01324:Ces3b APN 8 105093252 missense probably damaging 0.99
IGL02418:Ces3b APN 8 105085647 missense probably damaging 1.00
IGL02612:Ces3b APN 8 105085269 missense possibly damaging 0.83
IGL03400:Ces3b APN 8 105092936 missense probably damaging 1.00
R0244:Ces3b UTSW 8 105092635 missense probably damaging 1.00
R0282:Ces3b UTSW 8 105083851 missense probably benign 0.00
R1833:Ces3b UTSW 8 105085639 missense probably damaging 0.98
R2130:Ces3b UTSW 8 105092975 critical splice donor site probably null
R3790:Ces3b UTSW 8 105086888 missense possibly damaging 0.50
R4827:Ces3b UTSW 8 105086895 missense probably benign 0.12
R5411:Ces3b UTSW 8 105088632 missense possibly damaging 0.94
R5790:Ces3b UTSW 8 105092638 missense probably damaging 1.00
R5798:Ces3b UTSW 8 105088440 missense probably damaging 1.00
R5929:Ces3b UTSW 8 105093165 missense probably damaging 1.00
R6437:Ces3b UTSW 8 105092606 missense probably damaging 1.00
R6470:Ces3b UTSW 8 105088653 missense possibly damaging 0.87
R6943:Ces3b UTSW 8 105093078 missense probably damaging 1.00
R7828:Ces3b UTSW 8 105086596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGATGCCAGCATCAATCCCC -3'
(R):5'- ATCCTGAGATGTGGAGGAGCCAAC -3'

Sequencing Primer
(F):5'- CCCAATGTGAGTACCCCTG -3'
(R):5'- TTTGAATCAGTGGCCCCAG -3'
Posted On2013-10-16