Incidental Mutation 'R0800:Usp19'
ID76237
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Nameubiquitin specific peptidase 19
Synonyms8430421I07Rik
MMRRC Submission 038980-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R0800 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108490602-108502337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108495154 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 469 (E469G)
Ref Sequence ENSEMBL: ENSMUSP00000141738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably damaging
Transcript: ENSMUST00000006854
AA Change: E470G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676
AA Change: E470G

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065014
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085044
AA Change: E470G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676
AA Change: E470G

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166103
AA Change: E446G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676
AA Change: E446G

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178075
AA Change: E471G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676
AA Change: E471G

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193412
Predicted Effect probably benign
Transcript: ENSMUST00000193558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193571
Predicted Effect probably damaging
Transcript: ENSMUST00000193678
AA Change: E469G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676
AA Change: E469G

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193975
Predicted Effect unknown
Transcript: ENSMUST00000194171
AA Change: E100G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194499
Predicted Effect probably benign
Transcript: ENSMUST00000194863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195763
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B230217C12Rik T C 11: 97,841,260 probably benign Het
Cacna1g T C 11: 94,426,439 D1498G probably damaging Het
Ces3b T A 8: 105,085,269 D103E possibly damaging Het
Chd5 A G 4: 152,356,157 Y158C probably damaging Het
Cic A G 7: 25,285,237 T1033A probably benign Het
Cst13 A T 2: 148,830,327 I141F possibly damaging Het
Dnah7a A G 1: 53,565,696 L1301P probably damaging Het
Dnah8 T A 17: 30,704,662 F1201L probably benign Het
Dok7 T C 5: 35,075,289 probably benign Het
Dzip3 A G 16: 48,953,808 probably benign Het
Eml6 A G 11: 29,749,877 V1753A probably benign Het
Fer1l4 A G 2: 156,045,663 F538L possibly damaging Het
Fmo2 C T 1: 162,876,814 D508N probably benign Het
Gabpb1 A T 2: 126,630,328 Y351N probably damaging Het
Gnaq T A 19: 16,335,064 V230E probably damaging Het
Gprc5c A C 11: 114,866,711 K48Q probably damaging Het
Gzmd A G 14: 56,132,491 L11P unknown Het
Hbq1b A C 11: 32,287,581 H123P probably damaging Het
Hibadh T A 6: 52,556,505 I209F probably damaging Het
Il17f G T 1: 20,777,953 C100* probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Itga8 A T 2: 12,193,551 V541E possibly damaging Het
Kifc5b T A 17: 26,923,184 V212D probably benign Het
Klra2 A T 6: 131,230,174 Y157* probably null Het
Kprp T C 3: 92,825,035 Y236C unknown Het
Mmp12 A T 9: 7,357,827 M414L possibly damaging Het
Myh6 A G 14: 54,953,278 probably benign Het
Nlgn2 A G 11: 69,825,997 F573L possibly damaging Het
Olfr1232 A G 2: 89,325,664 V172A probably benign Het
Olfr1406 C T 1: 173,184,060 A125T probably damaging Het
Palm2 T A 4: 57,709,650 D198E probably benign Het
Papss1 T A 3: 131,599,854 probably benign Het
Parp4 A G 14: 56,589,951 T181A probably benign Het
Piwil2 A T 14: 70,409,037 probably benign Het
Pla2g12b A G 10: 59,403,820 N17S probably benign Het
Polr3c C A 3: 96,719,311 V266L probably damaging Het
Pou3f3 A G 1: 42,698,367 T408A probably damaging Het
Pskh1 A G 8: 105,913,606 Y306C probably damaging Het
Rom1 T A 19: 8,928,908 D89V probably damaging Het
Sell T A 1: 164,066,201 probably null Het
Sox6 A G 7: 115,579,014 probably null Het
Speg T C 1: 75,423,489 S2527P probably damaging Het
Stat3 A G 11: 100,894,155 probably benign Het
Stra6l A G 4: 45,882,797 T503A probably benign Het
Tapbp A G 17: 33,926,253 T375A probably benign Het
Tgm6 G A 2: 130,143,422 V382M possibly damaging Het
Trappc9 A T 15: 72,953,132 probably benign Het
Txlnb A G 10: 17,799,492 N131S possibly damaging Het
Vmn2r17 T A 5: 109,427,326 probably benign Het
Zfp750 T C 11: 121,512,012 T637A probably benign Het
Zhx2 A C 15: 57,822,728 I498L probably damaging Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108498961 missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108493858 missense probably benign
IGL03026:Usp19 APN 9 108493145 missense probably damaging 1.00
IGL03057:Usp19 APN 9 108499130 missense probably benign 0.01
IGL03073:Usp19 APN 9 108495803 unclassified probably benign
IGL03333:Usp19 APN 9 108494149 missense probably benign 0.05
PIT4504001:Usp19 UTSW 9 108492970 missense probably benign 0.00
PIT4576001:Usp19 UTSW 9 108492732 critical splice donor site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0138:Usp19 UTSW 9 108501315 missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108498509 missense probably damaging 1.00
R0386:Usp19 UTSW 9 108499711 missense probably damaging 1.00
R0454:Usp19 UTSW 9 108494240 critical splice donor site probably null
R0506:Usp19 UTSW 9 108494487 missense probably damaging 1.00
R0542:Usp19 UTSW 9 108494385 unclassified probably null
R0829:Usp19 UTSW 9 108493801 missense probably benign
R1594:Usp19 UTSW 9 108498522 missense probably damaging 1.00
R1917:Usp19 UTSW 9 108499325 nonsense probably null
R3744:Usp19 UTSW 9 108500181 missense probably damaging 1.00
R3964:Usp19 UTSW 9 108498029 missense probably damaging 1.00
R4275:Usp19 UTSW 9 108498694 missense probably damaging 1.00
R4789:Usp19 UTSW 9 108493234 missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108496065 splice site probably null
R5249:Usp19 UTSW 9 108492608 start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108500193 missense probably damaging 1.00
R5445:Usp19 UTSW 9 108497920 missense possibly damaging 0.61
R5578:Usp19 UTSW 9 108493440 missense probably benign
R5934:Usp19 UTSW 9 108492567 unclassified probably benign
R6003:Usp19 UTSW 9 108496380 missense probably damaging 1.00
R6217:Usp19 UTSW 9 108500144 missense probably damaging 1.00
R6230:Usp19 UTSW 9 108501941 missense probably damaging 0.99
R6505:Usp19 UTSW 9 108496883 missense probably damaging 1.00
R6585:Usp19 UTSW 9 108499727 missense probably damaging 0.97
R6865:Usp19 UTSW 9 108498819 nonsense probably null
R6953:Usp19 UTSW 9 108498931 missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108496958 missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108497135 missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108494924 nonsense probably null
R7705:Usp19 UTSW 9 108501913 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCGACTTCACACATGCTGCTAACC -3'
(R):5'- ACTATCCCCACTAACTGGACTGTGC -3'

Sequencing Primer
(F):5'- TGCTGCTAACCACCAGCC -3'
(R):5'- gctgggatttgaactccagac -3'
Posted On2013-10-16